Description :
From Genome Similarity Track
Location :
Scaffold_425:1689- 2792
Transcript NameFunction/comments
Aphas_H257_19237reverse transcriptase

Sequence
1103 bases(100 bases per row)
CCCCCACTTGAAATCGAACCGTCAAGCATCGGTGGAAGGCGGGGGTGTTAGAGATGGACGGCGTAGTGGGGCGAAAAGCCAGTGGACGCCTGAATCGAAG
CGTTGTAAGCGAAAACCGTGTGCTGTACCGTGACAGCCCACGAGAAGTCGGTAGAGACGGAATAGCTCCGAAGATTATCTTCCAGGACACTGTTGGCGCG
TTCCGTTTGGTCGTCGGACTCGGCCCATCGGTTAGGGCAAAACGATGCATGGCCGACGATGCGCAGCGCGATTTGGGGGAAACGGGGTCGGTAAGCGCCG
CCAGGCGCGACAAGCAGTCAGCGTCAAGGGGGTATGCCGCGCGGATCCGATCGTGAAGACCAGACGTCAAAAGACCGATCATTGTCAGTTCGAGATTGGG
ACGCCGAGACAGGGCGTCGGCGAGGATGTTGTCCTTCCCGGGCTTGTACTGGACCGCGAAGGTGAATTCGGAGAAGAACGAAATCCAGCGCGCCATGCGA
TGAGAAATGCGCGGTGTGTTGGTCGCCATGCCAAAGGACGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN