Description :
From Genome Similarity Track
Location :
Scaffold_271:16882- 19252
Transcript NameFunction/comments
Phyag_g4158hypothetical protein PHYSODRAFT_564649

Sequence
2370 bases(100 bases per row)
CGGGCCTGCCAACGGCTGGGCTCCAGTAGAGGAACGTGTGAAACCCTCGTCATACCCACTGCCGAACGACGAAAGCTAGAACAGTTAGGTTCCTTAGATT
TGTGTCGAGGTGTCGTTGGGATCGCGTAAAACGCCATCGATTATGGCGCAGAGCTTCAGATGGTGTGCAAAGTTCTCCAAGTTCATGCAGTGGTAGCTGG
ATACTATGGATTGTTCCTCGGGAAACCTTGCAAATACACAGGCAGAAGTACTGCCGTGGTCTGTAGCATCGCAATCCCGCCGTTTGACTGCAACGAGCAA
TGTCCAACGAAACACCAGAAAGAGAAACTGTGGTAAAGTCACTTATTTACACGTGATCAGGTATGGTTGCGTAGCAATTGAGCCGGACCACCGGGATTCG
ACATCTTCTGATGatgacttgctgctgtttgcagGATGTGCACACAGATTTTACTGTTCGAGAATGAGTGCATCCAACATGGTCAAAACGAGCTGTATTG
GTTGCAAATAATATACGCATGACATGGTGTACTCTGCTGCCTTGCGTTCGTTCGCCCCACCACCATTTTCAAATGGTGAGCGACTTCTCTTCTCGCCGCT
GGTAAAAGAGCATGTAAGCGCTGGAACTGTTGAGTTCAGGCTTCTTGATAGCTGTCACAGACCCATCGTTGAAGTCGAACCACTCCTGCGTGTCCGCGTT
GAGGCACTCGGCCGTGTAGTGGCCACCGTTGAGCGAGCCCATGTGGTGTACGATACCTGTGAGATCGTAAACTGTACTGCCGTCAACGACAGCATCCTTG
GCGCAATACTCGGCGATGTCAAGACACTGCGCCGGGAAGTTGATGTTCGTGCTCACCTTGTCGCGACTGAACGTGGAGTAGGAGAAACGCTTGaggtgca
gcaccaacacgttCGGTAGCCGGTAGATCGagatcttcttggccacaTTTCGATGCGtcttgcacttgctgcagtaaTAAGCTGCGTCATCGCTCAGGAA
CTCTTGCTCTGTGTACGTCTTCAGGCAATCGTGAATTGACACGCCGCCATTGCTGGGAGAAGTACTGTTGCTAGCTGTTCCATCGCTCGTAGCTGACGCC
GCCCTACCACCAGAGAAAAAGCTGCTCGATATCCTCATGTGACTTGAAGCACTGCTTTTCCCGGTCTTCTTGGGCACGGGTAGTGACAGATCCCAGAACA
CATCGAAGCACAGTGATCGGTGACTGCACGTCTCGCAGACAATCTCTGATCGCAACTGTCCGCAGAAAAGCTCCGACAACGCGCTGGCATTCCGCTCGAG
GTAAAACTTCCAGTATTCGTCCGACACATCTCGGTCCTTGGCATCCGGTCGATCTTTGATCTCGTAGTACGCCGGTTTCTTCTGGACTCGGTTGAGGTCT
TCGTGCAGTCCGTCGAGCAAGAAACGCAGAAACTCCTGTGCGTCCTGCTGATCGTATCCCGTAAACCGCGACGCCACCTTGCCAATCACACGTTTCAGTT
CGACAGGTCGAGTGGAAGTAAACTTGTCTCCCGTCCAAAGCGCCTTGATGAGGTCGCCAAAAGCATTGGCCAGAGCGCCCTTGGTCGGACTTGACTCATT
AATTTCCCGCGCATAAAGCCCTGGCTGGAAATACTTGACAATTGCTGGTAGATTGCTCACACACTGCAGACAACTGTTCATGAAGCTGTATCAATTGAAG
AGCGATCGTTAGCAAACATCAAGCAAAACAAATCAAAACAATCAACAAGCTCAAACGTACCAAGTGTTGCCAAGGTTCTGCAGCCCCACGAGTCCTTGCG
GTTGTCTCTTCCTCGTAAGCTCGTTCCTGGGCGACGTCCGTccgctattgctgctgttgacaCGTGTCGGGTACGAGATCGACGATGTGGTTGTCGCCTG
CGATGCTACAATATTGCCAGTGTTGCTGGTCGGCGCGAGCCGAGGCAGCTCGCACGATGGCGACGAGTTGTTGCCAAAGTCCAGGTCGTCCGTGTTCTTC
TCTCGACTGGAACTGCTGGTTGTCGACTGGTTGGCGTGACGCGAATGAAACCGAgtcaacgacgccaacgccgacGTCGCCCCCGTCGCGCGTGAAGCGG
GCGCGTCCGCGGCCACCGCTCGGTTAGCAGGTCGGCCGAGGAGCTTGCCACCAATTGGCGGGGGCTTGGCCGCCGCGACCGGGTGGTCAAAACTGTCGGT
CACGGAGTCCGCGACCTTCTTGGACCTTGTGGAGAACGGCACCCGCATGGGGACTGAGAGAGATGACAACAACGAGACAAGAGTCAGTAAGTTGATCCCG
TTCAATCCGCAGCCTTACGACACGACGGTCCGTCGCACCTGCGCTGGCGACGCGGTCCTGCCTGAACATG