Description :
From Genome Similarity Track
Location :
Scaffold_111:1688- 3617
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_111-snap-gene-0.20Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP43

Sequence
1929 bases(100 bases per row)
CAGCGTTACTTCAAGCTGCTCGCGCAGCGCCAGAAGCTGCCGGTCTATGGGTTCCTGAACGAGATCCAGGAgtCCGTCAAGTCGCACCAGGTCATTGTGA
TCGAAGGTGAGACGGGTAGTGGTAAGACCACGCAGATCCCGCAGTTCCTGACCAATATGACGATTCCCGGcACGTCGAGCAAGGCTCGCATGGTCGCTTG
TACGCAGCCGCGTCGAGTGGCAGCCATGAGTATCGCCAAGCGTGTGGCCGAGGAGATGGACGTTGAGCTCGGTCAGCACGTGGGTTACACCATTCGATTC
GAGGACGTGACGTCGGCGAACACGCGCCTGCGCTTTCTTACGGATGGTATGCTCCTGCAGCACGCCATGAGCGACCCGCTGCTCTCCAATTACTCGGTCA
TCATTCTGGATGAAGCACACGAACGCACATTGAGCACGGACATCCTGTTCGGTCTgTtGAAGGAAGTCATGCCAAAGCGTCCTGACCTCAAGGTCGTCGT
CATGTCGGCTACGCTGGATGCCAAGAAGTTCCAGGCGTACTTCGATGACGCACCGCTCATCTGTATCCCTGGTCGTACGTTCCCAGTCGAGATCTTCTAC
ACCCCAGAGCCACAACGCGACTACGTCGAAGCGGCGgTGAGAACCGCTGTGCAGATTCACGTCTGTGAAGACGAAGGCGATATCTTGCTCTTCTTGACGG
GTCAGGAAGAGATCGAGACAGCATGCAAACAGATCCAGGCCGAAGCCGATaCTCTGGACCCCTCCAAATACGGCCCTATTGCCGTGTACCCACTGTACTC
GACTCTTCCACCTGCTCAGCAGCAGTGGATCTTCCGTGACGCCCCGAAGCCaCGCTTTGCTGGTGGTCCTAAGGGCCGCAAGATCGTCGTCTCGACCAAC
ATTGCCGAGACGTCGCTTACCATCGACGGTATCGTGTACGTCGTGGACCCAGGCTTCTCCAAGCAGAAGGTGTACAACCCGCGAATCCGAGTTGAGTCGC
TTCTCGTCTCTCCAATCTCGCGTGCCTCGGCCAAGCAGCGCGCTGGTCGTGCTGGTCGTACGCGTCCTGGCAAGTGCTTCCGTCTGTACACAGAGCGCTC
GTTCCTGAACGACCTGACCGAACAGACGTACCCGGAGATTCTGCGCTCGGAGATGAGTGGTGTCGTCCTCACGCTGAAGCAGCTTGGCATTGACGATCTC
GTTCACTTTGACTTCATGGACCCGCCAGCACCTGAGACACTCATGCGTGCGCTCGAAATGCTTCACTACCTCGGCGCGCTTGATGACGAAGGTGATCTCA
CTGATCTTGGCAAGCAGATGGCCATGCTGCCAGTGTACCCACAACTCGCTAAGATGCTCATTGCCTCGGGAGAGTACCAGGTGCCACAGGAAGTCGCGAC
GATTGTCGCGATGCTCTCAGTTCCAGAGCCGTTCGTGCGTCCAAAGAGCGAGGCAAAGGAAGCCAACCAGGCCAAGGCGAACTTCGCGCACAATGACGGC
GACCACCTCACGCTGCTCAATGTGTTCCAGGCGTACAAGTTGAACGGTGAGGACAGCAAGTGGTGCTACAACAACTACTtGAACTACCGCAGCTTGCAGG
CGGCCAACAACGTTCGTGAACAGCTTCTACGCAACATGAAGCGTCTCGAGATGCCGACGCAGACCACAGTTGACTTCGGCTCGCCTCACTACTACACGAA
CATCCGCAAGGCTCTCGTGTCAGGCTTTTTCATGCAAGTGGGCCACAAGGCGAGCGCTGGCCCCCACTATGTCACGGTCAAGGACAACCAGGTTGTACAC
CTTCACCCATCGTGTGTGCTCGATGACAAGCCGGAATGGGTCGTCTACAATGAATTCGTGCTCAcAAaCCGCAACTACATCCGCCTAAACACACGTGTGA
ACGGAGAGTGGCTCGTGGACATCGCCCCT