Description :
From Genome Similarity Track
Location :
Scaffold_1190:1688- 3513
Transcript NameFunction/comments
g14171.t1XP_009527365.1 hypothetical protein PHYSODRAFT_332128 [Phytophthora sojae
g14172.t1hypothetical protein

Sequence
1825 bases(100 bases per row)
TGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGAAAACTTCAACAAGAACC
CCGCTGGCTATCGCGATCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAGTTCTCGAAGCGTGGTAAACCTGAACGACTGCACCATGGTGCAGTCGGTAT
CGGACTTCCTTGCGCAGTGCCTTACGACACTGCTTGTGAGTACTGCTACCCCGGAGCAGTACGCATCGCCGAGCGGGACATCAACGGCTACACTTCTATG
TGTGTACCTGACGACCTCAAGACCCTGCGCGCTAGTTTTCAGGCGCAGGCGTCTTCTAGTGCTGCGGATAATCGCAGCACTTATTCGAGTGCTGTAGGCG
ACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGATGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTCCTCCATCAGGACATTC
CGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATTCGAAAATGAACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGA
CGATCCAGCGAGTTGCCCCGCGTGCGTCTCACAACGAGGGTGGGGGCGGCGGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGAGTCTCGCTTGGAGG
CTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTGAAGGCTCAGCTCGCGGAGGCTGCGCAGACGACCTCGAACGT
AAAGGTCGAGGTCGGGACGAGGCTCTCTGCCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCACCAGACGTAGGTGACGTACGGCTTC
AGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATACTTCACCAACACGGTCCAGTGTGTACGCG
TTGCCATACTTCACCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAG
CAAACAGAACTAATGAACCAACTTTCAATTCATTTGTGTTTCCTCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATC
TTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTC
AGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTCCGTTGTGGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCAT
GACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACT
TAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTG
TTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTG
TTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATC
TCGATCCGACACAATGTCGATGGGC