Description :
From Genome Similarity Track
Location :
Scaffold_79:16879- 19580
Sequence
2701 bases(100 bases per row)
TGCTACGTATTTTTGTGTCGGCGGTGACAACGCTGCCTTCCAACGCGACATGCTTCGCACGGCGGAATTTTTGTCCTGATAAGACCATTCCACGAACATA
GCCTTGATCCGCCATAATCCCTAGATGATTTTACAATTATGTTTAAGACGCTTGTGCCAATGAATCATGGGAGCCACACCGTCTGCCCTTAAATAATTTG
ATTCTGCCTAAGGTAACTCTTCCGTCATCATATATTCAATTAATGGGTCCTCCGCATGACATTCACTCTCCTTATTAGATTATAACACACTTGCGTTAAG
AATTGGTGTCGCGCTTCGCGGTAGGTGTGTCGAGATCCTCCACATTCCGTCATGGTGCTCTGCTCGGGACATTGGTTGTTCACAATAATTTATCATGAAA
CTTATGATAGACGTATCTATTGTCATGTCAAATCCTTGCTTTAGTGCCTTGCCTGGGGAGAAAAATCTCTATTCCGCATATGAGACGTCCAACACGTCTT
CGAGCAGAAAGCCTTTTTCTTTCCCATCGACCAATGTACCCATTTTAATTGAAACCGTTCTAGTCCCTCCTGCATTTAAAGCTGTTGATATACCCGCGAG
GCTGACCTTTGACTCAGGTTAAATCGAATTGTAAACGGCAAAGTCGGCTCGATCGGCTGGCACATGAATATTTTTACCGTTGTCAAAACACCAGATGTAT
GTGCCTGTCTGTGATCCGTCTTCCCGAGGAATTAACTCCAACTTCACCTTTTGCACCTCATAATCTTGGATGCGACTATTGTCATCATTTTCCATTGTGA
AATCACATATTTTAGTTTCACGATCACAGACTTGGTTTCGCTCATTGACCATCTCCGACCTCGCCTTCTTTGGTTTCTTCGCAAAATATAGGCGTGTCTT
GGGCGATTCTTTCACAGAAGCTTCATTACGGAAACGTTTTAAATTACCTGGATTGCCGCACTTGTAGCAAGTCCTAGTTTCATTTGCTATCTTCACGTTC
CATTTTGTTCTTGATATGTTTGCTGCCTTTTGTTGCCTCTGCATGTTCACCTTGTACGTATCCTCCATTAGCATATCCCTTTGTTGTCCGTCTTATCTGG
TATCTTGATCTTGCAGCACGAATTTGCTCTTCCAAATCATAGGTAACCTTAGCTGGTTCATTTTCGAACCAGTTCTGTTTAAATTAACCCAAAACATTCT
GGCACTATGCAAGGTAAACTCTGTAGTATGTGCATCATTTTAGGTAGTAAACGAGAGCTGGATTCCATAATCATCCAGCTCGAGTCCTTGTTTCCCATCT
TTCGTAGATGATCCTCGATGTCGTCGTCCGTGTTGTATCGCACCCGGCAAAGCTCTACTTCAAGCCTTAGGACAGCATGGGAGGTAGAAACGGGTTAGAT
CTATTCTCAAATCGCTTACACAACGTCGCAATCAGAGCGCGTCCAGTTTCCCCTGACCTATACAGCTCCGCCAGCCTGTCGAAAGTGACATCATTATCTC
TCGTCGAAGTCGCTGCCAAAGAATTTTTTGATTAACCTTGCCTTCATCAGTTGAGAGATACTTCCGGTCAATGTGGCTGGATGCAATATTCCAAAGTTCC
TAATCTATATCTGGTAGCGCTCTTATTTCCATCTCCTTGTAGGTATGCCAGTACTTACCCTTAAAGTAGTGTGGCATTCTATTCTTCGGATACAGCTTGT
CAACCAGTTAAGGGACCGTTGTTGTGTTAATTTGGGTTTGGGGGTAGAATGATAATTGTGTATTAAATATATTTAGGTCCCTAGATCGCAATCTCTTCTT
GCTAGTCTAGACCTACTGGATTATAGCAACTATGCATTCATGATCGCTGTATCGCGCATAACTAGTTTCCACATCACACATTACTTATCGTCTAGTCGTG
CATTGTAATCGCCACATCGCGCATTAGTAATTGTTTAACCATGCATTTGGTTGCCGCTTGCATACATAGATACTTTTTCGACAACAGTTACAACCATACA
TGTTTTGATCGTAAACATGTCCGTAATCGTATACGCAATGAGCGGTGTTATATCGACACTACTAATCACCGCTATTGTTGTATGCGCTTAGGTCCGATTC
CACTGGACTGCAGTACGTATCTATGTCGTTTGGTCCCTAGAGCCTTCATCAGCATGTCTGCCTATTATTCCACCTTAGATACGTACTTGACCACAATGAC
ATCTAGAGTCATGTTCTCCCGGATAAAAGTGATGACGAATGTCGACATGCTCGGTCCTAACATTGTATCCTGCATTATTGGCAAGTCCAATTGTTCCCTG
ATTATCTTCCCAGATCAATACTACTCTCACTGGTCATGACCGAGATCCTTTAGTATGGTTTGGACCCACAATACTTGTAGGTACACAGGGTCATAGCCAT
GTATTATGCCTCTGTCGAGCTTTAAGCCACTGTACGCTAACGCTCGACTGAAACGACTGGTGCGCCACCANNNNNNNNNNGAGCCACTTCGTCGATATCC
TTGATCGCATTGATGACTTCGGTCTCCTCCGTAATGGACGTACCATAAATTCTAGTTTGCCCCTCGTTCGTCGAGATTCACCAATCATGACACCTTGACC
TTCTCCAGCTCCACATCATACATGCGATAGCCCTATGCATTGTTGTCATAGACAAGAAACATAAGCTTTAAGCTCTTTGGCTCCAGCTTGGTGCGGTAGA
G