Description :
From Genome Similarity Track
Location :
Scaffold_167:16875- 19022
Transcript NameFunction/comments
Phyta_totarag4937hypothetical protein PHYSODRAFT_515231

Sequence
2147 bases(100 bases per row)
TCAatcgctgctggcggtggcgctaGTATTCCGCTCCAAGCTGGGGTTTGACGGCATCGACCACGTGATTGACGCTGTGTCGGTGTATGCAGACTCGTCG
GTCGAGTTGCCACTGTCTAAAGCCTGTAAATTCGGGTCCGTGACGCTGCTTGACCGCATCTGGAACAGCACCATCGACCTCGGGCCTCATGGTCGGGGTA
TGTGGTCCGTAAGGAAACTACTGCGGACGTATCGACTGTACGGTAAGCTGCAGTTTACACTGTGTCTATTGGCTGcaatcaagatcgacaatGTGGGGAT
TGTCCAATGGATGTTTGAGCATTTCCCTGACTACGGAGTGCGACGGAAGGTGGTGTATgaggcgacagcagcgggGGCTCTGGAGATCCTTCGGTACTTC
CGTGCAAATGGCACGACGATccacaacgacgaagaagagcaggaagaagatggagaatgggacgaggagaaggaaaacTGGGAGAGCGGCCGCTGGGTTC
ATTGGGGAGACCTCGACGCTGCACGCGCGGCTTTGGCGGGACACACAGACGTCGTGAGGTGGATGTACGACACAGACGGCCATGAGGACAGGAACGACTA
CAGTACGATAGATGCGGCTTTCATCACGGGGAACATGGAGCTCGCACACTGGGTGATGGATAGAGTGGGGATGGCACCAGAAGGACCTAAAGCACCTTTT
GGCGCTGCCGCAAATGGACAtgtggaggcgctgcagtggTTCCAAGACCAAGGCAATTACACGTCGTGGGATGCGGGAaggcagctgaagcaggcCAACT
GGACGTTGTGCGGTCAATTATTGATCGCGATTGGAATGACGAGAAGCTTGGAACTGAAACTGGCCCAGACGAGTATAACTTTAAGTTTAGCTGGCAAGGT
AGAACGCGGCGGACGTATCTCACTTGCTTGGGTGGGGAAGCGACTCTGGCTATTCATGCCGCCGCCATCAATGGCCATTTGGATGTTGCCAAATATCTTT
TTGCCCGCATCAACATGCCGATCGACATCGAAGAAGAATGGAGTGAAAATCAAAGGCTGAGGAAAAGGATCGATGCTATATCAAGAAGACTTGGGGGAAA
CAGCAACGCTGCAAGAGTTTCTGGGGAAACGATGGTGCTTGCTGCGCAAAAAGGTTTCCTTGATGTTGTGAAGTGGCTCTACGCCGAATATCATGCTGAT
CCGAGAATTAACCTCTTCGGTGTCTGTGGACACCTCGACGATGAATTCGGATACAGCAAAGGTGGCAATGGATACGATGATAGCGAGCAGATCTATTGCA
GCGCAGTTGATGTAGCGGCAGCAAACGGCCACTTGGAGATCGTGCAATATTTGCTTCAAGTGGGAAGAGAGCGGGAAGCTGCACGTGACCACAAGCGTCG
GCGCACTCAAAAAATTCCGGACTATGTCGTTCGTGGCGAACCGCGCTGGTTGAGCTCACAAGAACTACCCGATGAGCCAACCAAGCTGGGGTGCACCACA
ACAGCGATGGACGGCGCAGCCGCTCACGGACATTCGGATGTTGTTCACTGGCTTCATGCTAACTGCGCGGAAGGATGTACGACGGCTGCAATGGACCTTG
CTGCTCAAAATGGTCACGTGGAAATGGTaaagtggctacatcatAATAGGATGGAAGGATGCACCTCCGACGCgatggatgctgctgcaagaggTGGACA
CTTGGACGTTGTGAAGTGGTTACACGAACACAGAAGTGAAGGTTGCACAACGGTAGCGATGGACAATGCGGCTACTGGCCACCTTGAGATCGTGAGATGG
TTGCACGAGAATCGGGCAGAAGGGTGTACGGCTGCCGGATTGGACGGTGCAGCTGCCTATGGAGAGATGAAAGTTGTGAAATGGTTGCACCGGAATCGTC
CGGAGGGGTGCACGACGCTGGCAATGGACAACGCCGCTCATGGCGGTCACCTGCGAGTCCTTCGATGGCTGTACGAGAACCGGAAGGAAGGCTTTACCGA
AAGAGCTATGGACAATGCAGCGCGGTTTGCTCAGTTCGAGTCACTGTTGATTCTGCACGGCATCGCGCAACAAGGACTCGCAAAAAAAGTAGAGACCATG
GACGACGAAACGTCGGGATCCTGGATCACTGAGCGCTACCGTGAGAT