Description :
From Genome Similarity Track
Location :
scaffold_5:168737- 171575
Transcript NameFunction/comments
Plaha_PHALS_13981flagellar associated protein

Sequence
2838 bases(100 bases per row)
CCTGTAGCCGTCGAATCCAAGAACTTTATCTGCAAAGCTTAACGCCGTATATTGCGACTCCATCGACAGTCCATCTCTTTCATTTTCAGAAGCTAGTAAT
GCTGCAAGACAACTTTGCAGCTCTTCTTTACTCATGACTTCCCCCTTGTACAGCAATCGAGCCTCAATTTGCTCCCATTTTAATGTCGCGGGCCCTTTAA
CCATATCATTACTTGATCCTTTCTCTGTCATCGCTAGAATAGCAAAAGCTCGTtcaatttgtgatctattGACTCCTACAACTGGTCGATGATTTACAAA
AAGTTTGATAAAATCATTAAGTCCAATACTTTCCACAGGTCGAGAGGTCTCAGTGAAGCGTGAATAGCGCACCTCGCTCACCATATGCTGAATTTCCTCG
TCCGTGGGGTAATATCCTAATGCTCGCATAACATTTGAAATCTCTCTTAGCGGGATTTGGAAAGTTATTTTGCGGACAGCAGACGATGTCTCACCCTGCA
CACGAAGTTGGGCAAGGTAGAAATAGTCAACTATCTCGTTGTAGAGAGACCCGTCCCGACCCCCTTCTAGAAGTGTCAGATACGGTGCAAGAGCCGCCTC
ATTGTCATTACTGTCTTTACAGCCGTCATTTTGAAGTGTGCATGCAGCCTCCATCAAATCTAACTCGTGAGGATGAATCTCCCACATGATTACTGCAAGA
TCATTGCCACCTGCAGTGAGTAAGTATTTGCCATCAAAAGTCACATCCACATTGCTAATTTTGCCCGGATGTGCAATAAGCCCCATTGCTTTTCGGGGGT
TCCCATCAAGAGGAAGCTCAAGCAATCCAACGACCATTTCACAAGTACTATAGACACAGTATCGTTGTGCGATGTCACCTGCAGCTTTTACGGCAATTTC
TTCCTCATCACGCAGCGGCACGGGCACCAACTTGTGGATTGGTCCACTGTATGATGGTCCTAGCGTTGTTTTACGGCAAGTTTGGTTGCCCATGTTCCAT
TGCTTGAGTTTATATTCGTCATCAGCTACAATGACCAAATCTTCGTGGACACCCTGTAATTCCGGGTGCCAGCAACACGCAGTCGGAACAGCACTTTGCT
CAATGCGGGTAGGAGATTGTTTCAAGACAACGCCATCCAAGATACTTGAGCGCTCTAAAGAGTATTCCACTAGAGTCCGATCTTCACTCACAGACACGAG
CACCGGTTGCCCATCACCATTCCGAAAAAATTCAAGCCCCGTCACGGGCTTCGAATGAGCTCGACAACGTCCTAAATACACCCACTCATCCACAACGTCA
GAACCCTCTGGAACCTGCTTTGCACGCCACATTCCAAGAAACAAGTTCGCGTCCAACGCTACAAACACTGACGACTCTGGACTCATTTTCACGTCAGTAA
TTGCCGATTTTCCAAGTCGAAAGGTGGccaaatcatcaaggctTTGGGCGTGTAACAATTTGACAACGCCGCTTGTGAAACCAACAAGTAGCTTTTGACC
ATCTTGAGCAAATGTTAGACattctggacgaagcttctcCGCATCAAAGCGCCGAACCATCACGAGACTCTTTGTTGAGTAGTCCCAGAGCTGTACGACC
CCAGAAAACAGACTTAATACAAACTGTGTAAGATGTGGGTGAGTCGCAAGTCCAAGGATCGAGTCATCAACGCCTTGCAGCAGTAGTGTACCGCGTCGTC
GATCAGTTTCGTGCTCTGCAAACAATGACGCACTCATACTGACGATAAATCCAGACGTTGTGGACACAATAAAGTCCGGGACATTAAGTGACTCGTCATT
CTTCAGACAGTCGTCGTTTTCAGCGTTTGATGGATCCATTATCTGAGCAAACGAGACACTCGCTACAGGACCAGCATTAACGTCTTCAAACCAAGCCACT
AAACGGAAGTCAAAGTCATAAAATCTCACGGCACCATCGTTCGAGCCAAGAACAAGATAACCATTTATATCGACTACAACAGTGAGCGCGACTTTATGGT
GTGGCTCTGCTCCACCTGCAAGACGTACGATTTTGACAGCTTTACGCTCTGGAAAACTGCCGGTGGGGTCGTCAGCGCCGTTATCCATTTGTACTATATC
CCAAAGCACAAGGTCGCCATCTTCTGTTCCAGTGAGAGCTTGTGCTGAATCGGGTATAAACAATGATTGCGTAAAGGCACCAATCGTCTGACGAAAATTT
TTCTGAGCAAGTGATGGAGAAAAGAACAGGAGCGTGTGCGTGGCCCAGCTCCAGAAAATAACCCGTTGGCGACCAGTTGTGACAAGTTCTCGAACGTCGT
AAGTATTGAAGCGCACAGTGTGTTGAACGTCCTCCGTGGCTACAAATGACGAGTATAGCGGCTTTGAAATTGCCGGTCCACCACTGGATGCTGCCCACTC
CCATACTGCCAGCTCTTGATCGAAACCCCGCTGAGTGGACGTCTTGCTGTTGGAAGCATCTTCACTATCACGATCAACAGCACTTAATGTGGCTAGAAAG
AGCGCATCGGGGGAGATGTCAATAGCTTGGACACCATTTGTATGCGGATGAAAAATGGTTCGAATTGGGTTGCCGGATAGAGCGTCCCACACTACAAGCA
TTGAATCGAGACCGCGATCGGCCGTAACAATAAAACGTTTGTCTTCACTCACGACACAGCAGGAAATAAGATGACAATGTCCTTGCAGCAATCTTTGCTC
TCGACTTGCATAATCGTAGATAACACCTGTGTGTGCTGCTGCATAAAATACAGCTCGACGCGTTCCAGTCGATAAATTGTGCACTCCGTTGACTAGATCC
TTTGAGAATCCAAATGTCCAAGCAAGTTTCAAGGCATT