Description :
From Genome Similarity Track
Location :
Scaffold_552:16872- 19712
Transcript NameFunction/comments
Phyag_g6573hypothetical protein PHYSODRAFT_506946
Phyag_g6574hypothetical protein

Sequence
2840 bases(100 bases per row)
CCACCCTTGCGAATGAGTTCTTGGGTTGCTTCCTTTTGCTTGgggagcaggaacaggaaaAGCCACGAGAAAACGGGCATCGCGTACATGATGACGATAG
TGTACGTGATATCGGCGCGAATCGAGTGGTCGTCAGCCTGAACTCGTtcgttgatgatgttgaacTGGCCGTCGATCAGCAACGTCAATGTCGAAGCGAA
TGGCGAGGATATGTTGCCCACAGTAGTGATAAGGCCACACATCGCACCCTCGTTCCCCATTCCGGCCAATTCAACGACCACGAAGGTGGAAATGATCCAC
CCGATGCCGTACAGAAGCTCGACGGCGATCGGTGGGCCGAGCCAGAACCATTGGCTACGGAAGACATCCCATACGGCGATCAAGGAGCACGCACAGTCGA
CTACCATGACAATAGCACCAGTCAGGACGGTTATTGTGCGCCAATTCCAAAGTGGCCCCCGCTTGGACGTGATCGTCATACCAGCTGCAAAGAGCAGGTT
GCTCAGGATGTCACTCAGCGTGCTGTTGATGGGCGTAACACCCACCATGTACGACTGCACAGGTGAGCTGGCAGTGTACGTGATACTGGCGAAAATGCCA
CTGAAAAACATGTACACGATCACTTGATACACTGCCCGACTGCAAAGCAACTCCCAGAATGAGTTGATATACTCTCGGAAGTCAGCGGCTACCgtctttt
cttctttgaTGAAGAACCACGTGATAGGGAGGACTGGATCCGTCAAAACCAGCATGATGATCATCAACTGAGGGAAACTCAACGAACAGTCGAAATCACC
ACCGTACTCCTCGGAAACCAACGATGATTTCGCCGAGGATGAGAACGATAGTGCGAACAGTGTAGATGCACGACTGGGTCTTGCCACGTTGTTCCAGTTG
TTCACGCTGGGCCAGTTCACATGTTATACTATAGATACAAACGTCAAATATTTAAGCGGCTTTCAGAACGTTCGATGTGTGGCGCCACTGGCAGCCAGTG
AGATCAAAGTGGTAGACTCCACCACGCTTGCTGTAAGCCCTAGTTTCCTGTGCCATTCCTGAATTTGCGGCATGGCAGCTACAGTGAAGAAGCATCGCCA
TCCTTCAGCGTCTCCTGATCACCGTGCAAAGATCAGGAGGACTGGAAACTGACCCCTAGGGAAAGTTTTGTGGCGCAGTCTCAAGAAGAATctccatgct
gcagcttatTCGCTCCGTTGCCTGCTGTTCGTACACTTCGAGAGTGAAAAGGACCGCAGGCGTATGCGCTTGCTTTTTGCTGGTCGCATGTGGAACACGG
CCTGGGCCACACTACGTCTCGACGATCCACCAAGCGCGTCAGAGATCCCAGCTCTCATGGAACGTTTGATGTCCGTGAGGCCCAACGCGGAGACCAATCT
CCTtgacgtggaggacgtgttGCCCATCTTAATCGAGTTGCTGGCTGCGTTGATCAATGCAGATGACGTTGACTACTGTCCTCTTCTAGATAAGTTACGC
CCTTATCAGCAACGTCGTATGGACCGCGTCTTTGATGCATTGTACCCAAGAGCGCTATCCGATGACACACCGTTCGCGGATCGcccgaacttctcgtcgt
gGTTCAAGATtcgcgagcagcacgctcgtACAAGGATCAACAAGACGATCGAGTCATTCCCTACCACAGCCAACTGGGCCGCCAGTGCAGCCGAgcaaca
agatcaagaacaCTGGATAGCGCGCAAGTATCGTCTCATGcctactgctgctcagcggcgggtgctcaagcagttcaTGGGCACCTGTCGCTGGACATAC
AACCAAGGGGTGGCGCACTTCAAGGCTACCGCCAAGTACAACCAGGACAACCTGATTACGTTGTGCGTCGCAAACAACACCACGCTCGAAAGAAATTACC
CAGAGCCAATCAACCCCAAGTTCCCGCTGGGTTCGGCTCTGGAATGGGCGTATCAAACGCCTTATCAGTTCCGAGCAAACGCTATGCGCATGTTTGATAG
CGCTGTGAAGTCTGCGTTCACCAACAAGGCCGCGAACAACACTACACACTTCAATATGAAGTTTGCGTCGAAGAAAACACACCGGTACTTCCCGATTCAA
GCACTACAGAGAAATACGTCTATCAAGTCACGCACGGACGCATCGGGGAACACCAAGCACTTCCTGCCCATTGCAGGAGTAAAAGACATCCGCATGGTCG
CCGATGAGTTGCCGGTGATAGGTGGTTCAGCGAACATCACGGTGGGTGGTACGCCGTGATCCCGTCGCAAGTGGACGAAATCAATTCGGCGACAGCACTC
GACCCCGGCGTCAGGTGCTTCTTGACGGGGACGGATATGGAGGGCAACATCTGTGAGATTGCGCCGGGcacgcaggagaagctcgatcGGTTCCGAAAGC
GGATCGCAGATGCTCAACGTGTGATCTCCAGGTTCAAGAGCAGACGAAAACATAGGTACAGGAACTATAGAACTTACGTGAGAGCCAAGCGTGAGTTCGC
CTGTGCCACCGCTTGTCAGAACAATGTTATTAAGGACCTTCACCGTAAGGCGTGCTACTACCTCGTGAACCGCTATGACACTATCATCTTGCCCAAGTTC
AGCACCTCGGAGCtactgcgcagcagcaaggcgcAAAACCACAAGTTCAACGAGCACCTATTGTCGCTGAagcacttccagttccgggagctgctgcgta
cCAAGTGCGTGCGCCCGGGGACGGCACTGATCATCTGCTCCGAGATGTACACCAGCAAGACCCGCGAGCGCTGTAACAGTCTGCACCTGACGCTAGGGAG
CAACCCCGTGTTCAAGTGCCCCCACTGCGAGCCCACCGCC