Description :
From Genome Similarity Track
Location :
scaffold_1370:1687- 4548
Transcript NameFunction/comments
Pl_100790hypothetical protein PHYSODRAFT_510353
Pl_100791hypothetical protein PHYSODRAFT_410384
Pl_100792hypothetical protein PHYSODRAFT_492560

Sequence
2861 bases(100 bases per row)
GTTCCGAGAGCTACAGTTGATTGTCTCGCCCCACGGTCGTGGTATTATTTTCCCACCTCGAGAGTGTGGGCACAACAGGCATTGTTTCACGAAGTCGGTC
ACGATTGCTGCGAGGTTATCGATTGCAAACAATCGCCGTAGATGCGTCATAATGGCGTGTTGGCCACGGTGCCCTTGAGCGCCACAATGCGCAACAATGC
AGAGACGCTGAATTAGATCTTTTGCTTCAGTTGGCACCCAGATACATCCTCCAACTGTAAGTAAACCGTCGTCGCTCTGATCAGCTTTGGGGGAAGGTTC
ATAATGCGACTGAACTTTACACAGTTCCATCAAGGTCGGCCATATGAAAGCTTCATCGTCTAGTGGACGGAGCGGAGTAATGCTAGTAAGAGCTGGAACA
TCTTCAGTTATTATACCGCGACGCACGGCTTTCAGACGTCTGGTCGAAATTGCAGGTGTATGGTTGCCGGCCCAACGCGAGATCATATCCGCCCACACCA
GGTACATGCTCCACTACATAGCGAAAATTCATCATTTTGATAGACCACCGGAGAAGTTTGCCTCGTACATGCTTCTTCACACTCTGATCAGGAGCGAAGA
CATGTACGAGGTTACGGTGATCGCAGTACATCCTAAATGGCTTTGGTCGGAGAAGTAAATAGTCCAATTTGTCGCAGGCAGTGACCAGGGGCCATGCCTC
TTTTTCAATGACAGTCCAGTTGAGCTGACTTCCGGAGAAAGTTCCACTCATGCAGTGCAGGAGCCGATGCTGTTGTTCAGTAGCGGGCACTTTGGGATTA
AAATTCATCACTTGTGTCAGTGCAGGAGCCGATGCTGTAGTTCAGTAGCGGGCGATTTGGGATTAAAATTCATCACTTGTGTCACTAACAATGCCCAACC
GACATCACTAGCATCCGAGAACACACACGTCGTAGCATTATCATCGGGAAAATCGAGGGTTGCCGAGTTTGCTAGTAGCTCCTTGACAGCGTCATACGCT
GCTCGCTCTTCTTGGGTGAGTTCTAACTCGATACCAGCAGCTGCTCGACGAGTCCGCTTCGTTCTGGAAAGTGCGGCGTCAAGTCGTTTCTGTAGTGGGG
CAACATGCCGAGCAAAGTCCACAATACTCTCTCTCATCCAGTTTATAGCGCATACGAACTGTTGCAATTCGCCAGCCGTTTGGGGGTATGGCATAGCGCG
AAGCGTGTCAATTCTCTCAGGATCATGACGATAGCCCTGGTGGTTGATCCATTTGCCGCACCACTTGACCTCCGTCTGGTACAGGATCGATTTCTTAGCG
CTCAACTTCAAGCCAAATTCATTGAGTAGAGCGAATAATTCTCCCAGCTTGACTAGGTAAATATCAATATCGGCAGCATACAGGAGCATGTCGTCTATCC
AGATAAGAATGTGCTCATTAAGGAGGCTCGTGAAGCAATCTTCCATGGGCTTCTGGAAATGGATGGCAACAACCTTGTGGTGCTCTGAGAGGAGTGAAAA
TTTTCTCATCGGTCATGTAAGAAAGTAGTTCTTGGCAACATTCGGCCAGTGGCAATTGCCAGAAACCTTTAATAAAGTCAAATAATCCGAAATGTTTCAT
TCCACGCACGTTCTCCAACACTACCGAGAGTATAGGCATAACTGCAGCCATAACGTCCGTCCTCTCATTAAGGGCACGATAGTCCGTAGTTTGCCGCAAG
TCCATAAACTCTGCAGACTTCTTGACAGGTAGAGCGGGACTCGCCCATCGATTGTGTGGATTTTCATATACCATTCATTTGATGGGTTGGGCCCCTTCAC
GCAGTCGTACCTCAAGCGGAGGCACGTTGGCAGGTGGATCTGCACGGAGTTCTAACCTCCAGATGTCGTAAGCGTAAGCGATTGCCCGTAGCTCCTCCAC
TTGCTCGCGCGGGAATCCGTTTTCAACTGCACGATCAATCAGTTTTTCAACTGCAGCAAAAATGTCATCATCGCTCGAGCTATCGCAATCCAGATTGATA
GGCAATTCATCTGCCTCGAGTTCAATCCCATCTCCACTGGTCTCATCTTCACTGCGCCCTGCTAATTGCTCTAGTTGGCGGTCTACGTCAATACCGAGGG
TCGTCAACAAATCGTTACCCACGATAAATTCATCATCGTCTACGTCCACAACAAGAACTTCAACAGCATTCATGGGTTCAACCGGGCCAGCAGCAGTATG
TATCAATATATGGAGGTTCGTCTTCTGATCAGCAGTCACCCAGGTCGAGCCAAAAGTTTGGTTCAGCACTGGAACCACGAGATTTTCTGCTTCGACACTT
GGGTCTGCTTCACGAAGCATCTTCCAATGAGAGCGACCAATGACAGTGTAGTCGGAGCCGCTATCGGGGCAATACGGTAGAGTCAAAACTCCATTCAAAG
TTATTTGTCGATCTGGGGACGGAAGCATTTCACCAAGACGCTTTACCCGAGTCTTTTTTGACTTTCGGGTCTCGCGTAATTGTTTAATCAATTCCACCTT
TTCTGCCTCTGTCGCCTTAGTACGCTCGCGCAACCAATGCAGCTCGCGGCATTTCGGACATGGACCAGGTGACAGATTAGCTGCCTTTGGCTTTGGCACT
GAGGGATTTACCGCCTTCGGCTTCACAACAGCAGCAGAAGATGTCACTATAGCAGGCGCAGCAACCTTATTGTTCCAATGCTTCTTAGGTTTTGAAAAGT
CTTGTGTCTTTGCCGCGTCTTGGCCGCGCCCCGTGGACTCCTTCTTTTGTTGCTTTAGCCGCTGAAACTGACGCTCATGCTCCTTTGCCTTCTCGACGAT
GAGCTCGAAGAGCTTCTTCGGATCGGTTGCTGCATCCTTGTGCGTAAAGCGAACGCACTGC