Description :
From Genome Similarity Track
Location :
contig_84:168691- 173268
Transcript NameFunction/comments
g12309.t1hypothetical protein
g12310.t1hypothetical protein

Sequence
4577 bases(100 bases per row)
TTATCCATTTAGAACTACGTGCCTATCCCCCATCTCTCTTGCGTATCTCATGATTGCTGACATTCTTGGACCTCCGATGTGCCGGTATTTGTGGTACGTG
CTGATCTGATCGGCTGATTTGTACCCATGTCAATCTGATCGGTCGATCGGAACCCATGTACCCAACATGTGGTACCGCGACCAAATCTGCCAAGATCGGA
ATGATGGTCTTCACATTCACCATCCGGTTGTCCGACCGTTGATGCCGCCCATCCCAGGTCCAAAGCCATCCATCCGTACCCATCGACCAATCACCTGGTC
GGGCACGATCAATCCATCTCCAAAAACTTCTGGTCACTTCTCCACAACCGCCCTCTGTGCGAGAGGCGATTGTACAGCACTCAACTCTCGCCACAGTCTC
CAACTTGCCGCAGTGCACCTACTCCTCCGACCGGGTCTGCTCGTGCGCCGTTTACGGCCATCTGCCATCTGCCTCCGCCATGTCATCCAGCGACCGATCG
TCGGCAACCCCTTCGCCTTCATCCGCTTCAAGCACTGCTTCTCCTGATGTAATCGACGCCGAACCTGCGTTGTCTCCCGTCGTCCCAGACATTACACGCG
CTATCCCCTAGGCATTGCGCCATGGCACGCTGCGTGGGCTCAGTGCGTATGCTGCATCGCCTCCAGCCGGTATTACACCGGCTGCGCAAGCTCCGGCGAC
CGCCCCCGTCCCGATGTCGATCACTACGTTATCCCAAGCGGATCGCGATACACTGCAGGCGTCGCGCGCCACGTTGGACCGGATACTCGGCCACCTGAGC
GATCAAGATGCGGTCCAAGGGATATACGCCGACTTGGCGCAAGATCACGTCGCCCTGCAGACTCGAGCCCACGAACTGGAGCAAGAGTTGGACCGCGTGT
ACTCGTCGTCGACGACCTTCGTGCAATCTGCTCAGGAGCAGTATTCGGCGCTGTTTCGCGATCATCAGGGTACGCGTCTCGCGTTAGCTGATGCTCACAA
TGCCCTGGCAAATCGACTCGACAACAGCCGCGCTCTCGACACGGCTCGCACGTTACTCGCCGCAGAACGTCGATCACACGACGAGGATGTGGTATTCCTT
CACGACCGGATCGGTGCTCTCGAGCGACAGGTTTCCGATCTGCAGGCGCGAGTCAACGCCCCATCGCCTCGAGCGCGATCAAATCGATCTTCTCGTCTCA
GCCGTCACATAGTGGTCCAGCAGCGAGACTTGGTTGAGTTGGGTGCGTGTCGCGATCGGGTGCTTGCTGACCTACAGCGTTCCCGTGGTGATCTGCAAAC
GTCTGAGTCGACTCGCCGCCAACTGGAGACCAGCGTGCGAAACTATGAGACCCAAGTCAAGAGCCTCGAAGACCGCCTTGGTGACCTTCAACGCGACATG
GACCGCCAACTGTCGGCTACACATCGTCATGTGGCGCGTAGCAACACTGAACGCGACCAGCTTCGCCGTCAGGCCTCCGACGCCTCCACTCAGCTCCAAG
CGGTCAGAGATCAACTCCAACGGACGATCACCGAACGCGATCAGGCCGCGACTTTGCTGTTGTCCTCTCGTACGTATGCGTTGCCTGCCCATGTCAACTT
CCGTGCTAACTGTATGTCGTTTCGTTCTCTTCCAGGTTCCACTGTGGCTTCTCTGAGGGCTGCCATCGCTCGCTTGGAAGGTGAAGTGACTCGCCTCCAG
GGCGATCGCAATCGCGTGCAAGTTTTACAGCGGGAGAATGCCACCCTGGCTGGAGATTTGACCGCTTCCCGTGCTGATCGCGCGGCACTGATTGATTCGC
GTGATCGAGCTGTCCGTGAGTGTGATGCCATCCGCCAACGCGTGGCAGGGCTAATCTCCTTCGTTCAACCCAGTGGTAATCCTCAAGATGAGAGTGAAGA
CCGACGCGAGGCCAACAACGACGATGATGTAGCTGACGAAGATAACGATTATGGCGGAGATGCTGATGTCGACGAAGCCAGCGTCGAGGATGGAAACGGT
TCGCGGCGTTTGAATCTGCAACCTTCTCGTCGGCGGCGTACACGATCGTTTTCACAATCGCCTTCGCCGCCATCACGACGTTCTCGCCACGCGTCTTTTG
GTCGTAGCCCACGATCTCCATCACCAACTTCCTCACATCATTCTGGACGACGACTTCGGGGAGGCAGCGGTAGCAGAGCCACTTCCCCACAGGCTACTCC
CGATCTGAGTGATGATGAAGAAGACACATTGGCTGCGCTTTCTCGATCTCGTGCATCTGATCGTCGGCGTCGACAATCTCGCGACTCTTCGCCCCGAGGG
TCACCCCATCGGCCGATTAACGTTGGTTCTTCTGGTTCCGACACCGAGGGTTCGGCAGACGGCGCTGGTGGACCTCCTGGTGGTTCACCTGACTCTCCGG
GTAGCCCTGCCGATTCTCCACCTGGTGGTGGCTCACCTGATTCTTCAGGCAGTGACGGCAGCGTACCCCGTCGCGATCGTACGCATCGGAATACTATACT
GGGGCGTCAGGAGTATGATCGCTTGGAAGGCACAACTGCGCCTCGCGATCAATGGATTCCTGGATATCGCGAGCGCGTGAGACGCCCCGCTGCGGATGTC
GCCCCGTGGGACGCTCGATACATACGTCGTATCAGTGTCCTCGAATTGGATTTGGACTTGCTGTTCCACCACTTCTGTCGGCCACGTAATTGGTTGATCC
CTGAGCGTGCAGCTCGTGCTCCACGTGATCATGCCTGGCGGTCAGATCTGATTACCGCGGCTCACGTCCGGGCGTTGTACGCAACGCGCCCCTGGGAGAC
TCTCCACACTGCCGTCACCCCGATTTCGTTCGTGCTCGTGGGTTGGTTTGCAACCATGGCTCGTCAATATGCGGACCTGATACACGAGCATGCGCAGGCC
GTGTGGGAGTCATTGCACTACTTCTCCATCAGCACCAGCAGTCATCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCAC
GATTCGGTGCTCGCTGGAAGTTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGACCCTTTCTTCATGCA
CCGACCTCGGCCGGGTGAGGAGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCT
GAGCCCTGGCGGGTCCAATACCGCCACGACATCCGATCGGACCCCGCGCAACGTATTGCGCGTCTTCGTGGCAAATTCGTCATCCCAACATCCCCTTAAA
CGTATACCCAAGTGTCAGTCTGCATGTAATTCACTTTTCATCTCGTTTTCTCCAGTGTTTCCCTTGATCGGGTCGATCGAACCTCGATTGGTTCTTCTCC
CTTCACACGACTTGTGTTGTACATAACTCTTCTTCTTCCTGAGTGCAGCCACCTGCCATTCACTTCACTTTCGCAGCGATCGTCACGAGTTGTCCTCCTT
CTTCCTGAGGGGGGGGGGGGGGGGGGTGCAGCCCTACACCCATTTTTACTCCCACTCGCAGCGATCGCTACGAGTTGTCCTCCTCTGCTCGTGCGATTGC
ATCCACTCCGAAGCGATTCCGTCTAGTACGCTCGCGCTCAAACTCGTGCAGCAAAGCCCCGCAGTTGAGGTCAGCCTCATCGACCCAAGACGGTTCGGTG
TATCCCTTCCAGAAGACCTGGAATTCCCGATGGACGCGTCCATATCTGGTCTTACGACCCGATCGGACATCTGCGATCCGCTCCACTTCAAACTCGTCAT
CGCTCCTGTCGCCTTCCCAGCTGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCACTCTCGTCCGTCGCTAGCGTCACGTCAGGGCGATCAGA
GAAAACCTTCACGGCCTTGAGCTTCGAGACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATC
TCGCGCACCCGGAACGGTCCGTGCCACATTTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGCGACCCGGCCTCAA
TCTGGTGCGACCTTATCCCGTCGTTGTGGCGATCGGCCCTCGCTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTG
CTGGATACGATATCTCCATCTGCGCGGCTCGCGGTCGCGACGTCGATCGTGGGTCCCAGCCATGGACAAGGTAGAACGGCGTCTCTCCTCGTACTCGATC
GTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTACTCGTCCCAGTCTTGCTGATTCACATCGGCGACGTACATCTTCAAGGCGCGGGTAAGCGTT
TGCACCATTCGCTCAGCGGTACCGTTTGCTTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGCGGAAGAAATCAG
ACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTCT