Description :
From Genome Similarity Track
Location :
Scaffold_19:168649- 170082
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007676Similar to HERC2: Probable E3 ubiquitin-protein ligase HERC2 (Homo sapiens)

Sequence
1433 bases(100 bases per row)
GCAGTGTACACTTGGGGGTCTGGGTCGCTCGGTCAGCTCGGTCATGGCGCGTTCATCAAGTCGGGCATCCGCAATGCGTACGAAGAGTTGTTGCCGAAGC
GCCTCGAGGCGTTTGAAGGCAAGAGCATCGTCAAGCTCGAGTTTGGCGCCACGCACAGCGCTGCGAGTACGTTTGCCTTTGTTTTCGTCATACTGGTGAG
CCCTCTGTTGCAGTAACATGGAAGCTAATGCATTTGCACCTTGACTATTATGGCAGTCGACGACAAGGGCCGCGTGTACATGTGGGGCTCGAACGAATAC
AACAAGCTGGGTCTGGGTCCAGGCACGGGCGAGTTCGAGAGCTTGCCGCATCTTATGGAGGCGTTTGAAGGCATCGAGATCGTGGACATTTCGTGTGGCG
ACTACTACACGGCCGCGGTCGACAGCGAGGGCAAGATGTACTCGTGGGGCTGGGGCGGCTCCACGATGAAGGGCGCCGGTGGCCTGGGCCATGCCGGTGG
TAAGGACGAGCCTACGCCGCGTCTCGTGCGCGCGCTCGTAGATCAGGGCGTGCCAATCGCGTCGGTCGAGTGTGGTGAGCTCCACACAGTTGCACTGTCG
AAGGACGGCGAGATCTGGGCCTGGGGCAACGGCGAGTACGGTCGTCTGGGCAACGGCGAGACCGACACGTTTGAGATCCCCGAGCCGATCGAGTTTTTCT
CGGATGAGAACGTCGTTGCAATTTCTGCGGGTCGCGACTTCACGTTCGCGTTGACCGAAGAGGGCGAACTCTACGGCTGGGGCGTCAACAGCCGTACGTA
TGTGTGTCCTGTTGTCGCGCAGATAGTCAGAGTTGATGGGCTCACTTTGGCCTCTCTTATGTACGTATGCGTCCATATGATGTAGACAACCAGTTGGGCG
TCGGCGGTGGTCTCGCGATGGATCACTACAACATGGAAGCGATCCCGACGCTCGTCGAGGGCTTCAACGGCGTTGGCGTCAAGCAGTTCGCGGCGGGGTA
CGACCACGCGGCAGCCGTGACCGACGACGGCCGGCTGTACATGTGGGGCTCGAAGCTGTGGCTCGAGCCGCACGAGATGACGGCGCTCGAGGGCGAGACA
ATCGTGCAGGTCGCGTGCGGACGCACGTACACCGTCGCGCTCTCGGCTGACGGCAAGGTGTTTACGTTCGGCAAGGGCTCATCCAACTGCCTCGGTCACG
GCGACCGCAAGAACCAGTTGCAGCCGCTCCAGATCGTGGCGCTCGCCAACATCAACGTCACGTCGTACGTAGCCAGACCTGCGGCTTTGTCAGCTGCGAA
TATGCGTTGAGACTCACATGTTTGATCGCTTCTTTGTTTACTTGTAGGGTCTCGTGTGGTGACTACCACATGGGGGCGATCTCGATGCCGCACGCCACCG
CCATGGACAAGGATTTCTCGTTCCGTGAATAAG