Description :
From Genome Similarity Track
Location :
Scaffold_505:16864- 21282
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_505-abinit-gene-0.25Phosphatidyl inositol kinase (PIK-A)
Pytve_DAOMBR484maker-pve_contig_505-fgenesh-gene-0.6GAF sensor protein

Sequence
4418 bases(100 bases per row)
CGTACGTTCCGCTGAGAGAGTAGGAATCAAGGTACGGTTGGGGTGGGGTGGCTGGCACAGGAGTCCCACCATACTGGTTCAGTCGTCGCGCACCCATATC
CGCTGAATACGAGGACGTCAGGTTTCGCTGCGAGTACGGCTCTTCCTCGTACACTACAACGTCTCCGAAGTACGGCATCTCGATCCACAGGAGAGCGTCA
TCTCGGTAGGAGCAGAAGGGTCCCAGTGGGTCCTTCTTCCCCGGCGGTTCGCTCCCGCGTCGGATTCGGGCGATTCGTCGGTCGGTCACACTGTCCATCC
ACTCGTTGCGTGTGATCTCCTTTCGTTCGTACTTCTCCCGAAGCTTGTCTAGGCGGAAGCACTCCTGTCGGACCCACTCGTCGTCGATCTCGGACGGCGT
GTTGGTGGCCGGCGACGAGTCCGCCTCGACTCCCTCCCAAATGCGCAGGCACTGGACGCCGTCACGGAGCACGCCCTGCTTGGTGAAGAACGAGATCGTG
GTCCCGCCGATGGGGACCCAGCCGACGCCCCAGATCGTGATGGCCAGCAGCGAGTTGCGCGACAGATCGCGGTATCGCACGGGAAAGGAGACCCACTCGT
TCCAGTAGATGGTCGACTCGCTGCACTTGGTCGGCCCCTTCGAGCTGTTTCGCACAGGCACACACACGGACGCCGTCCATTGAGCAAAGCAGCACGCAAC
TCGGCACACAGACACCCCAGCGACCGTACCTGATCACCATCGGGTGCAGCGCCAAGCCGTCCGAGAAGATCTGCGCCGTTATGAACATCTCGCTCACGGC
CGCGTTGCGAAAGTCGGACGACGTGCCCGAGAGCTGCTCGAGCCCGCTGGCGCGCGCCGCCGAGCCATCCCTGCCATCCTTGCTCGCCGAGTGGCCGATG
ACCGGGGAGAGCTCCACGAGCGAGATCTTGATCGAGATGTTGGTGCTCACGCCGCTGCTCAGGTAGTAGCGGTACTCCTTGAGCCGATTCGCCATCATCT
CGCGACCGGCCGGCGCGCGTCACGCAGCGCCGCCCCCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGGACGACAGACAACTGACAACAAGCACACC
GCTTCCGGAAGAACAGACCAACGCACTTAGCGGGACACTCACGGTACGCCTCGCTGCCATTCGCGCCGACTCCTGGCCATCTTCCCCATCATTCCACCAC
GTTCAGCGCCGCCTTTCCCCCATCGACCACTCACTGGCGACGCACGCCTTGCGGACACCTTGCTGACATATTTGCAGGCAACGCGCAGCTCCTCCAATGC
AGCATTCGGCGAACCGCACTGTCCGGAGTGCCCCGAGCGAACACGCACGCAAAACCAACTTTATACACTACAATCTGGGAGATAAAATTTAAAGACAGCG
CCAACGAGCGGAAGGCAAGAAAGAGATGATTTGGACGAGGGGAGGCTGCGCGACTCCCCACGGGTGTTCGCTGTGTTTTCCTTTCCGCTCGCGGACGTGC
TCGACGGGAGTCGGCCCGCCTCCCTCCGGTCCTCTGCTTTTACTCTGCTCGCCGAGTTGTCTTGTCCTCCTCTGGCACCCCCCGTCGGCATGGACGGGCT
CCGTTACTCCGCCATCGCGTCTAGTTTCGCCTCCATGCGCGCCATCGCCGTCGCGAGCTTGTCAATATCCTGCGTGTGCTGACTCAGCGTGTGGAACATG
GCGCCTTGCTGTGTTGCTAACTGCTGCTGGGTCTCCGTCGTACGGCAGAGCAAGTCCATCAGCATCGTCTCCATCTTGGGACCTGCCGTCACCTGGCCGT
CACCAACGTTCGCCGCCACCAGATCCTGAGACTGCGTCACCACAGGAGCAGCCACCACCTGGTTCGCGATGCCAATGCCCGACCCGCGCAGAGGCTCAGC
CGGCTGGCGAGGAACCGGCGCAGGCAGGGGCTCGCCGTCCGCGCCTTCCAGCGGGGTCGCGACGGCGTTCTTGCGGTCTTCCAGGTTCTTCATCGCCACG
TTCGACAGCTTCTCGAGCGTCGCGATATCGCACGAGTTCCGCGGCTGGGTGTCGAACACGAACACCGTGCCGAGGATGTGGCCCGTGGGCGTACAGATCG
GCGCTCCGGCGTAGAAGCGGATCTTGGCAGCGCCAGTCACCAGCGGGTTCTTGGCGAACCGCTTGTCGAGCAGCGTGTCCATCACGACCATCGGCTCCTT
CGACATGATAGCGTGCGCGCAGAACGACACCGAGCGCGGCACCTCGTTCTGCGCGAGGCCCACGCTCGCCTTGAACCACTCGCGGTCCTCGTCGAGCAGG
CTCACGGCCGCGATGGGGCTCTTGAGCGCGTTGCTCGCCAGGTCGCAAATGATGTCGAACACGTCCTCCTGAGGGGTGTCCATAATGTCAAAGCCGCGAA
GCACCTCGAGGCGCTCCGTCTCGCCCGACACGATCGGCGGCTTCGGCCACGGGTGGTCCCAGTTGAAGTCGAGCGGGTAGTCAAACTCGGGCTGGTGGAA
GTCGCGCGTAAAGTGCGTCAGGTCGCCTTCCGAGTTGCCCGTCGGCGAGTGGAAGTTCTTCGTGTCCCACGTCTGCTCCTCGCGCGGCGGGGGCGACGAC
GACGACGCCGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGTGCGACAGGATGCACGACATGCACACGCGCACGAGCGAGCGGCCGATCACC
GGCAGCTCCGCCTCCTTCTTGAGCGTACAGTTGCCGCACACGACCTCACCGCACTGTTCGCATCACCAAAAGCAGCAAGAAACAGCCGAGGCGTCAGCGC
ATCTGAGCCCACCAAGCAGGAAGAAGCAGCAGCGACCCAAACGCCTGCGTGCATACCTTGCGGCAGTGGTGCTTTCGCCGGAAGCGCGTGAAGTTGCGCG
TGCACACATGGCACCTGTACCGCTCCGTGTCGAGCACCCAGTCGTCCTGGTGGCGCAGCTGGTCGATCGTGAGCACGTCGTTTCCGCCCATGGAGCTCGC
CGCCTTGAGGTTCTTGCGGGACATGCCGGGAGTGGCGAGGGGACGTCCGTCAACAACACTAGCACCGCACCGAGTCGCGTTAGTGCCCAATCGAGCTCTG
AAGGTTCGGCTAGCTAGCTAGGCAGCCAGTCCCCCCCTCTTCCCCCCCCTTCCACCCGCGCTTCTCTCGCCGCCATCCAACGGCGGGGAGACAGGGAGGG
AGAGGGCGACACCAAGTCACCAGACACACACTTACATGCAGGAGGCAGCTACCGGCGAGGCGGGCGGGGCTTCCTAGCGGGCGGCGCGTCGTGCGGGCCG
AGGGGAGGCGGCGGTCGGGTCTGGCGCGCGCGCTGCGGGCGGAGGGGGCTTTCGCTCTTTCTTGCTGCGTCCGCCACGTCGGCCGTCCGTCCAATGCCAG
CCGAGCCCGCAGGGAAGCCGTCCGTCGTCGAGGGTTTCTTTGTGCCCGGGGGGAGTCGGAACCGAACGGAGGAGGGGGGGAGGCAAACAAGAAAAACCTA
AATAGAGCGCGGGGAATAGAGCGCCAAAGAGGTTAAACGTGCCGAGAGAAGAGCCACGGCTCCTCGCCTGTCGACTGCTCGTCGCCCGTCGTGACGTCGT
GAGCCGAGCAGAAACGAGGCGGGACGTGAACCGAACCTCTGGCTGAGCTTCACCCGAGCCGAGCGAGCCTGACCCTTCTCTCGGCTGGGGTTTCTGGCGG
CACGGGGGAGGCACAACCTCTACGCGACCGGCCGATGCGCGGCGCGAATGGGCGAGCGGTAGAGCCATTTTGGGCGGCGCGCGTTTCACGCCACACGAGC
CGTGCGGTAACCGTAGTAGTTTTGGTGGATGTGTCCAATAGGATGGAGATAAGCCCGGCAAGATTAGGGTCGGACCCCTATTTGGGACGTCTCTCCCGAC
GTCCTCAAACTCGCATGCCAGGTCCCTCCTCCCGCGAATTATGGAGGGCTGTATGCGGCCTCGCTCTAACACGGACAGGCGACATTGCGGCCCTATTTTA
TCAGGTACAGTTGAGCTGTCGCCGACACCTGAACCTCGCCGCCCGACCAATAGCTGTCCAGTGTGCCTCCACACTCCAAAACGCAATGCGACGACGGCGA
GTTGCCTCAATGCGATCTGTCCTGCGCTGTAGAATGGCTCCTTCGCTTCTAATCAGACCAATTTTTGCGCTTTGAGTGGCGAAATATCACAAAGAATCGC
GGTTGTGGGATGAATTTTCGATAATCAGCATCCAGCTATCAGCTGCAAATAAGCGGAATTTTGACTTTTAGTCGCTCACGAACTGGACGTAATATTCGAA
TTCCATGCAAGATTGTCCATTATTCGCTCGCTCTTGGAATGCAAATTGCGGCTCCACTCGAATGTTGGAGAATGCTGTGCTGACTCACGCAGTGATGGAG
CGGCGACTGATTAGCCGC