Description :
From Genome Similarity Track
Location :
Scaffold_41:168638- 172425
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14733hypothetical protein
Phypa_INRA-310PPTG_1473460S ribosomal protein L7a-2

Sequence
3787 bases(100 bases per row)
TTGGCACTAAGCACCATCAAAGCCTGAGTGACATCGATGCCGTAAGAATTTGTGGCGACAGGGGTTGCTCCTGGCAGATACGAAAAGGTCATCGCAAAGT
CCCTGGCTTTCGTATCAAGCTTTTGATGAAGCTTTTTATGAGCACCCGCTTCATTGCACAATGACGAATGCAGCTTCGAGAAGCTCTCTTGTGTAGTAAC
ACGAACGCTCTCGTACTCACTCTTCATGGTGGCAAGGCTGAGAGACACGGGCTCGGCAAGTAGCGATCGGAATTCCTGCATTGCAACAACAACCATGAGA
ACAACGCAGGAGACTATAAAGATCTTGGTAGCATACCTGGTGAACTTCCAGGAGAAGCTTTACTTGATCCTTCACTGCCATCCAACCATTCGCCATCGAT
GCACCTTCATCAGACAGGAAGTTCATTGTATTGGATGATGTGCCGAATAGATCTGTAGGTGGGGCGTGTCCACCGTTTTCGTGCAGTCGCAGTAGCTTAC
GCAGAGAATGTGAAAAGCGGGTCTCGCTCGCAATAAATTCTGTCACCACTGAGTTGATGATTCCAACCATCCGGTGTCCGGTGTCCGACATCTCCTGGAT
ATGCGTCATGCGTAGGTAGGAAGGATTAGTCGACAAGTCTGCTCGGTCGACATCTATCTCGTCTTGGCCTCCAAGACTTTGGAACCCCTTTTCAATATCA
GCTAGGAATCATTCATAATGCATCAGTAAAGTACCAACCATTACAGTGGTGATAAGTCTGCTTACCCAGTTCATCAACTTTGTTGGCGCTTGCTTTCATC
CGCTCGACGAATTGCTGAGACCGCGAAAACATGCTAATAAATGCCTTTTGCATGCGCATCAGTACATCTCGAAGATATTCGAGACGCTGCTCTTCTGTAA
GCTGAAAAGCGTGCAAATTCTCCTTGATTTCCCGCTCGAAAATGAGTCGCTGCGCGTTTGTGTAATCCACCGTATGAACGTAGTGCTTTTCCGCGGCGAT
AACGTCTTCAAGACTGCTATACAACTTTGATCTCTGTCGCTCCAACGGGTTGCGTCCAAAAGAAGACGTGGTATCCCACATCTTTGTCAGCAATTGCCCA
GCACCTGCTGCCAGTTTGTCGGTCAGCTCCTTTGACGCTGAAACTTCATCTGACGAGTCAGAGGACGAGGAATTAACGTCTGCTAACGTGCTGTTGTCAC
TCTTTCGCATTGCTGTCGTGATCTCGATCGCTTCTTGGCATTTGCGATCGTACTTTTCTTTTGCTTTCTCCATCGAAGAAATCATCTGCTGTTGAGCCCA
ACGCACCTTGGTCCCCTCTGCAAACAGTTACAAGAAACCAACTGCGTTAAAATCCTTATGACGCCATAATAATTATAATGAAAACTAATAACGTGACAAA
CCTGAAACGAGTCGATGCACCTGAGTTTCCTGCTGCGCCGCGAAGGCCTTGGCACCAGGAACAATAGAGGTCTGCATGGTTTGGGCAAATGCCCACCGCT
CTTGAGCCAGATGCTCTGTGGCTTCTTGAAATGTGGCCCAGCATTCTGTAAATTGCTTCGACCAGTCTTCAGCCTTTGCACTCCTGCACAAGCGCACCAA
CAGAATGATGTCAAAGTGAATAGATCCTGAACAGTTCAGCAATAGCCCTACTTACTGTGCCAGCTTAAGCAGTGACTGCGCGTAATTGCTCTCCAGTCCC
GCACGCTCAATGACAAAAGCTGAGACGGCCTGGCAAAGTTGCACGCCGCTTTTTGCCTTTTGACAGACTTTTGGGAAAGATTGGAAAAGGTCTGTCGAGT
ACGTTCCCTCAGTCTGAGAAGAGCGAGGCCACGCCACGGAGCCTTCTTCACTCTTGGCTGTTGGACTGACACCGCCGTGGTTAGGAGAGGAATCGGACGT
CATTGTCGAGCTGCTGGAGGAGTTCTGGGGCTTGTTATCATCAGGCGATGTCTCCTCCACTTTGAGATCCGCCGCGAGTTCTGTTGGCGTAGAGCAGTTA
GAAGGGAGATGAACGCATTGAAAGCTTTATGGGTGAGTGGAGAGAAGATCGACAAAGAGAAATGTACCAAAACTCACCCATTATGAACCCAAGAAGAGCG
CGTGAGCTCTGCTTTGCAGAAGGTCGGACGAAAATGGAGCACACTTTTTCTAAGCAGTTTCAAACGCTTAACTGATATCATTGCAATTTGACAGCATACA
AACGCCTAGTGAAAACAGCGAAGAAGTCGTAAAAGCGGTGAAGCCTTGACACCCATCGTGTATCCATGCTACGGATACATGATGCCTTTGCTTTTACTGC
GCTTAATCCATGTGTATCCTGCACTGCATGCCGGCAGATATAATAATTGTGCACGTACGCAATGTGACTTTAGATGTTTGAATGTTATTCAGCCATTACA
CTTTCCAGGAAGGACTACGCTTCCTGTCGAGAGCACCTACGAATAAAGAAGACAAGAGGTGGCATGCCACGCCACATTGCGCTTCAAACCCGGTACATAA
CTTAGTACTGGGCCTTCTTGGCAGCTTCAGCGGCGATCGCCTTCTCGCGCAGCTCCAGCTTCTTCTGGGTCTTCAGGCCCATGATGCCACCGCCCCACTT
ACGACGAGCCTGGACGTCCTCGTTGAACTTGGTGCGGAACACCTGGGTCAGCGAGTCGAACTTGGCCTTGTCTTCCTTGTTCACGTGCGTCAGAGCAACA
ACAGCGGCGTTCTTCTGGTGCACAAGCTGGCCCAGACGAGCCTTGCCCTTGACAATGCAGTACGGGATGTCGAACTGACGGCACAGAGCGGGCAGGAACA
CCACAAGCTCAATGGGGTCAACGTCGTGGGCAATGACCACGAGCTTGGCCTTCTTGTTCTCGATCAGCGAGGTCACGTGGTTAAGACCGAACTTCACGAC
GGCGGGCGGGGCCGAGGCCTCCTCCTTGCCGGCAGCGATGTTGCGAAGACGCTGGGTCTTGGCGGCCTTGGTCTCCGGCTGGTACTTAAGCAGCAGCTTG
AACAGGTCCGTGGCCACGTTCTTCTCCACAGTGTTGGAGAACTGGTTGATCGACGGCGGCACCTTCAGACGCTGGTACAGGACCTTGCGCTGACGCTGAA
GACGTACGTAACGTGGCCAACGCACGAAGCGGGACAGGTCACGCTTGGGCTGTAGAGAGAAGTTAAAAGCAAGACAGTGATAGAGTTAGTAAAGCTGTTA
TATGACAAAACACGTCCTCCACGAGTGAGCTTGTGCATGACAATAGGGCAGAGAGCGAGATTCTTTACCCTTGAGGCGCAAATCATCGCGAACGAATGAA
ATTGCCACCACAAGTTTGTGTCATTGCGGTCGTGGGGGACCCGCTACACTGTTATCAAGTGAGACAGAGAAAGAGGGGTCGAGTCACGCAGCACTTTGGC
AACGCACTCAAACGTTTTTCCTCTGTCACCACTGAGGGGCGTGAAATCGCTGCCTTTGTCCCTCTCATCGAGAGACAAAGAGGCTAAACGATAGGATTTA
GAGACGGCGCTTCAAAATACCTGAATGTCACCGCCCTTGCGGAAGTTCTTGGGGGCAGACACGAAGAGGGGGTCCTTCTTCGAGGCAGCCGAGACCTTGA
CCCCCTTAGTGGTCTTGGTCGTGGTGGTGGTGGTGGTGGTGCGCTTGACCTTCTTGGTGGGCATGGTGATCGTAGATGGCGAATAAACGAATGGGGCCGT
TACGGTTGGTGTCAGCCGAGAAGCGCCCCACAACAGCCAGTCATTCGAAAATGCGAAGTTTCAGCCAATGAAAGGAGGCATTGAATT