Description :
From Genome Similarity Track
Location :
Scaffold_57:16863- 22049
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014038Similar to Calmodulin (Fragment) (Strongylocentrotus purpuratus)
Pytul_DAOMBR144PYU1_G014037Protein of unknown function

Sequence
5186 bases(100 bases per row)
ACGAGAAAATGCACACACCGCAAAGCCAACGCGAGATCCGAGCGCTCTGTCGCCTTTTTCGCTCGACGGGCGGGACGAAAGAGGGTCAGCCAGGTTGCTG
GAAAAACCGAGCTGGATGGTCAGCACTTGAGCAAGCTGCAACAGAGTCTCCCGAGACTTTGCTGCTACAAGGCACGATAGAGATGCAGTTTCCGCTATAT
GGGGTGGTCTGGGAGCGAAACCACGTTGTCGCTATCGACCTGTCCGAAAATGGACTTTCTGGCAAACTTCCAAGTGACATCGCGCACCTGCGGTTCCTCA
AAACGCTCAAGCTCCGCAACAACCCGAAATTGGTCGGAGCCATTCCACCTGAAGTGTACTCGATGCCGCATCTTCAGTATTGCTATCTCGACGGCACGAA
ACTCGAGAAGACACTTCCATTCCAGACCGCCCATTCGTTTCAGATCACGCGGTTCCATGCTTCCGGCACAGCAGCCACGGTTTGCTTCCTCACAAATTTT
CGCAATAATCAAATCCGATGGACATCCGATATCACCGAATCGGAAATGTTCATGATGCACTCGTCGTTGAAAGCTCTTCACGAACGTCCCAAAACACAGG
AAACTGCCATTGAGCGCAACGCCCGCAACGCCACCGGACCTGAGCGAACCGAGGCAGTCATCAAGTTGCAACGCATCTACCGCGCAAGAATCGAGCGCAC
CAAATTCAGGAAATACCTCAAATCGCTTTTTGAGCGCAAGTTTGACCCGAGCAGCGGTTTCGAGTATTTCGTTGATACTCGCACTGGTGAAGCCTCTTGG
GAGAAACCAGTGTTCATTAAAAGTCCGCGAGATTCTGGCGACAACAATGACGAGCTTCTTGGCGACCAGAACATTGCTGAAGCTTGGCAACCTTACGATG
ACGGCTACGGGAATACGGTGAGTATTTCGCTTACTTTTCAAACCACACATATTCGATTAGATAGATACTTACTTCATGATGCCTTTTGCAAAATCAGTAT
TATTGGAACAGCATCACTGGAGAGTCTACCTGGGAACCACCTGTCTTTCTTAGCCGCATCTATCAGGAACTAAAAGCTCGATACGGATCGGACAAGACGG
ACGAAGAGCGTTTCGAGCTTTTCTTCAAAGACATCGACAAGGACAGCACTGGTGAGATCAGCAAGGACGAGTTCGCTCTCCTTTGCGGTGAACTGGGAAT
GGCGATGTCGGACAAGCAGATTGGCAATGTCTTCAAAGAGCTGGGCACGAGCGGTGATGGGGAACTCAATCGCCAAGAGATCATAGCGTGGCTGACTAGA
TCGTACAACTAATAACATATTTTTCTATTGTCGCACCGGGCTTATTCACTCGTCATCTCCCAATAGCTTGAGAAGCTTCTCCGAGTCGGCGATCGTACGC
GTTAAACCAATTATCTGATTTCCAGTGATCAGGTAGGTATCTGTGCATGAGCAGGTGACCGTATTCGTACCTTCAGGTACTGCTGCTGCTGCTGCATCAG
ACGGTACAGGTCGCTTGCTCTCGTTCTCACCAGATTCAACTCTTTGAAATCTGGCATCAAACTCGACAATGACTGAATAACCACTGGCGTACATCCGCTT
TTCGTCCACTGAAATGACTTGTAAGCACCTGTTCAGTAGCGACACGTACTGGTTCATGCCGTGCTCACCATGGAAAGCGCCCCAAAATGGCAGCTCTTCT
GGTACTTCTGACTTGATAAAGAAATTAGGAGAAACCACCGGTCCGAGTAAATGAACGTTCGGAACGACATAGTAAGTCATCCCTTCTCTTTCCCGCTTCG
TTGCCACGCACTTCACCAGCATGATATTTTCCTCGTCATCCGCTTCAGTGATACTATTCCGCATAGCCTGCGAGTCAGTCATTGCTTGCTGCATCCCCTC
ATACCACATATTTCGAGTGGCATCTGTTCTGGTCACAAATGTGAGAGTCTTGTCCACTTCCCGACTTCGATCAAATGCTTCAACTTGAAAGCCGAATGCC
CCGGTACCTGGGTTTTTCACGCTTCTACCGAATGCAATCCATTTCCGGGAGTTACAGACGACGTATTTCTTCCGTCGTGACGTCCAATGTTGAGTTTTTG
CCATCAAATAGTCCTTCAGTTTTGTTGTAGACTTTCCCTTCACTGGGGATGAGCTGGAGCCAGCAGAAGACCGAGCAGGCACCGGTACGTCCTCTAAAAT
CAGCAAGCAGCTACTCTTCTCGAATTTGAGATGAACTTTCACCCATTTTGATCGTTTCTGATACACGTATCCAGAAATACTGTCTTCGTCTTCGACCAAG
TCGAAAGACGTTCCAGTGTCTCCCTTCAGGACATCAATAATCGATTGCGGGTACTGACTCTGTGTGCGACTCCGGAACATGTCGGTCGGGTTGATGATTT
CGTTTCCTGTTGCAAGATTTTGCGGCGAACCAAAGCCTTCTTTCTCCATTGGTAAACGTCGAAATGGCTCGAGCTCTTGCGATAGAAAGCCGGTCGCAGA
GGAAGTGCGACGCGCAAGTGGAAACACGTCATCAACTCCATCACTTCCTCGTCTTCCATTCGCATTGTTCAGTCCACTGCCGTTGAGCGAGCTAAGTCCC
AGTACTGAATCATCTAGCGCATCAATTTGCTGATAATGAGACGATACCAGTGACGAACTGAATTCAGCCCATCCGGCAACCTTGTGGCAATACTGTCGAA
TCAGCTCTTGCTCCAGACGTGGCGAGCTGCATATTTTGTCGATCTTGACGCCGATAATCGCGAGATGAGCATCGTAGGGATGAGTGGCAGAACTTTTGTG
CAACTTGTGCATGATAAATGCTAAAAGTGAATCTGGGGGTCGAAATACACTCCGCAGGAGTGGATTGTTCACTCTTCCATTTGACGACACGCGATCAAAT
AAATTCAGGTACAACTTGACGATTCGACAGTGCAGGATGTTTGCTTTCGGGAACTTTTCAAAAATGTCAATCAATGACGTCGACAAGTCACACTTTGTTA
GCTGTGCGTCCAAAGATTCTTTACCCATTCGAACAACTGCATCCAAGAAATCAATCACGTGTATCACGAGCAAAATTGATGCAAGCGGCCGATGGTTGAT
TAAATTCTTTCCGGAGGACGGCGAGAAACACGTAGCAGGAGGTGGGATGCTGCTTTGGTGTAGATGCCTTTGCATCGTCGCGGGTGCAACTGGAGGACTT
GTAATAGGAAGAACTTGCGACAGTAACACAGACTGGTTTTGCAATTCATCACTTTTGGAGTCATCGCCATTTGTATCCTCGTCTTCGTCCATCGAGTCTT
CCGAATCACTGTCGCTGAAGCAGTCTCGTGACGCAAACTCGGAGATCGTAGAAAAGTGCTGGTGATAGTTGATAGCAGCACAGAGATTCTCAGCGAGTAG
CTGCACTGGCGGCACGAACAACTTCAGTCGGTCTTTATCTGACAACGAGTTCTCGATGCCAAATCTCAGAACGTCGATGACCAAGGTAGGAGGAATTCCA
GCACCATCGGCGTGGTTTGCGTCCAAATACCGTATTTCTGCTATTGCAACTTCAGCTAATCGAATGAGAATGTTTGGCCTCTCAAGGATAGCCGACATCA
CCCCATTCTTGATTTGTTCATGCAGAACGCGATCATTTGGTAAGATTTTCGGAGGAAAGATCTCGCGTTCGAAAGCTTCCACACTTTCGTACGATGCCAG
CTGGAGCTTTGTCTGGATGTAATAGCTGAACGTGTTTGGAAACTCTTGTGACAGCACTTTCGCTAGAACATCAGCACATCCACTGATTCGAGCGTGGGTC
AACGGACTTCGTAGATTGAACTGGGAACGCGCCGATGACGGACTTGAAGGCATATAACCCGAATCAATTGGTTTCTCGATGATTCGCTCGACAAGACTCT
TGATGATCGGCTGGAACCCGTAACTTCGTCGTTGGGCGAGATGAAGGAGGCCATGCAGCAGCGTTGACACCTCCGGATTGTATGCATAGTTGGCGAATCG
CGCAAAAAGGGTTTCTTTTCCTTGCACTTCGATTGTCGATAAAATCTCATGCACCGCTGGATATGTCACGAAATTCTTCGTGATTCGGCACATGTTTGCA
AACAGGACACTGTCAATCTCGACCTCTGTATCGCTATCAGCAGTCCCCGCTTTACTCATACTAGCATTTACTGCAATTTCCTTCTCCGAGCTCGACTTTG
ACCACATAAACTGATACAAACCGGAGAAAATGCGCTTCCATTCCGTACCTGTAAGATCTTCCAGATGCAGGATGTATCCTCTGACAGCGGCGCTCGGTTC
ACTCACATCAGAAAAGCTGCTGCTACTCCCTCTTCGAAAGCTTCGTGTTGAAAATGCGGATGGGCGAAAGCCTGTAGAGAAGCTCAGCAAGAATGGCTTA
GGCGGCAGCGGCAGCGAGGGCGATTTCTTGTTTGGACTTTGCGAATTAGGCGAGCCAGTCTGTGGGGAATGCGACGCGTCTCCGACTGGCTGCTCCTCCG
AGCGCTGATTCTCCATCACAGTCGCTGGAGCAGCGAACGACAACGCTTTAGGCGAGCCGTGCCATGTCAGAGCCTTCAGGTAGAATCGCAGGATAATCTC
TGTCGCGATGTACGGGCGTCGGTACTTTTCCGGGTCCGAGATGTGATCGTTCGGCGCAGGCATTTTTTGCTCGAGCATAATCGGCAGCCTATTATGGCTC
GCCTTGTGGTGACTGCTTTTTTCGGGGAACGTCGTCGCGTACATAAACACCTGCGCAATGTTTTCGGTCTCGAGCAGCATCATCTGCATGGGGGACATCG
CGCGTTCGCGCTTCTGCACAAGCGACAGCACCGTCTCGGTCTCATAGCACGCGCAAAACACGTTCTGCAGCGTCTGCGCCTGGCGCAGTGCCTCTGAGTT
GTGCAGCGCATGCGATGTCTGGATCGGATCGCGCACGCCAGACGTGTTGCGCGGGAGCCGCCCATTAAACGGCGGCGTACTCGTACTCATCGACGCTAAC
ACCGGCGGCTGCCCACTCGCGGACGCTGATATAGATGCGCCAGTCGCGGCTGCTGCGTCACTCCTAGCGAACGCGGGCGAGATGGGCTCCTCCTGGTCAC
CAAGCGGCACCTGCGGCTGGTCGCTGTCACTGTCGGCGTCCGAGTCCGACTCGGTCTCCACGGCGCACGTGCACTTGCGTGGCGCC