Description :
From Genome Similarity Track
Location :
Scaffold_566:16863- 18286
Transcript NameFunction/comments
Phypl_g9451hypothetical protein

Sequence
1423 bases(100 bases per row)
TTGTCTTGCTGCCGCCTCTCCCCGCCTGCAACCCCTGTGCGAGCGTACTGTAAGTCCAGCTCAAGATCCTCGTATTTGCATCTTAGTTCACGCTTCTCGG
CTTCCAGTTCTCCGTTTAGCCGTAGTAGCTCCGATATACGAGATTGGATCGCTTCCAGTTGACGCATCAGGTCTTCATTGAGTATCTTGGTATCACTAAG
CTCAGCTTGCAACCGGAgttccttctccttcgaccCTGTTGCCTttgcagcagcctcaagcTGCCCCATGAGCAAACGTTCTCTTGTTTCCAACGCATCC
ACGCGGTTCTTTAGCCGACCTACCTCACTTTGATTGCCTCGTTGCTGTCTgaggccaagcagcggcagTTGCGTTTGCTTTTCCTCCAAGTCTTTCTCAA
GCTGCttgcgtcgctgctgctcaatcAGTATGTCATCTTCCAGAGCATCCAAACGCTTCCGGAAAGCCTCCCACTTCGAATTCCGAGCTGTCCAGTCGCG
CTCTTTTACCTGCCCTATCGCATTCTCCAGAATTTGCACCTTGTCGTTTGACTTCTCTCGGATCGCCGATAGCTCCTGAGCTTTtttctccatctccagc
tcaAGCCGTTGATTCTTCAAGagagtctgctgctgtgtttCTGTGACTAGGTCGTATTGCACGAGGAACTGCTGATAAGTAGTCTTGATCTGCATCAatt
gatgctggagctcgccTACAATTGCGTGATCTTCTGAGGAAGCCATCAATTCGCGcagctgctcttcttcctgttcacGGTTGCCCtgctcttgagcagc
acgcttcATTAGAACATTAGCCTGAGACGCCGCTAGTGAAGCGATATCCTTGTACTTTGCGCATTCAAGCGCAAGGCTCTCATAGAGTTGCTCCACCTCG
TGAATTCTCTCGTACAGAAGCGTATTCTCGTTTCGTAGCTCGTTGTCATCCCCAGAACCCCCCTTGAACACTGGTGATGGCATTAACTCGTCGTCATGGA
GTAGTCCTTTACAGCTAGCTTCGTCAAGATCCTTAACGCGCTCCGTTTGCGCTTGAAGCTCGTTCTCCAATTGTGTTATCCTATCTTGAAGGATTTCAGG
ATCACAgacaccttctccagcaccgctCTTGGAACTCTTTTCTGCCTGCAGTACCATAAGACTGTGTTGTGTTCGGCTCAGTTGGGCTGGCAAGTCGTAC
ATCTCTAGATACCTGGCATGTATCTTTGCGTAACTTTCACTTAAAGCGTTGTACTTCTTCAGGACGTCAGACATCGCTTGTTGTTGCTTGTCAGCAAAGT
CGCACAACACACTCTtttccagcgtcttctccattCGTTCAATCATGTCGTCGGCACCCTGTTTCCACGTTTCAAGGTATAGAACTCGATATTTCAGCGT
CTTTTCCATTTCGCTCCACTCAC