Description :
From Genome Similarity Track
Location :
Scaffold_33:168517- 169577
Transcript NameFunction/comments
Phyci_574075Hypothetical protein
Phyci_222051Hypothetical protein

Sequence
1060 bases(100 bases per row)
cagcgctacaagacacaaatccgcgacggctccttctctgccaagcgtcatggcaatcagaagaacaaaaatgcagcGGTCATTGATCTAAAATGGGTCA
CTACCTGGTTCAAAGAATTCGCGGAAGAAGTTGGTGAGGTGGTTCCTGTTCGTGTTCGAGTGAAAAAGACAGACAACGGCCAACTTCGGAAGTTCGAAAG
CACTGAAAAGTATACCTTCCTTCCGACGTATATTACGTGGGATCGCTTGTTTGAAGAGATGCAAGAGTTCGTTGAGCTGTCACGCATTCGGCGACGTGAG
CCGGCCCGTTctacaatgaaacagttactagcgcttcattgcccggagatccgcatcaggtcgccccgcgataacgtatgcgatgtttgctcaatctacg
taacgaaaatgcgtcatggtggatctaacgacacgacagaagtactcggtcggcacacggagtcagccagacgaatgcggtacgacaaaagatccatttt
gttttcgctgtgtgttggtgacaattttttaattgactgttggttttgtgaataggttggagtacaaagcagacctaaaaaaagccggtgacgtctgtgc
tgttgttgtcatggactttagccaaaatttaacgggcccaagtgtctctgagacgccctcgatgtggtatttcttgtcgttgttatctattagtgtcttt
gggatatactTTGCGAACGACAGTAAACAGCACAACTACGTTTACGACGAGCGCGTCAGCGGCAAGGGAACCGATCAAGTGAATTCGATGCTGCACGACT
TTCTCAAGCCCAACGTGATATCGCGCAACATCCGCCGACTGATTGTCTACGCCGACAACTGCGGTGGACCGAACAAGTCAAACTACGTGATCCACTTTCT
ACTAGCTCTCGTCCACCAAGGATTGTTTGAAAAAGTGGATTATAAGTTTTTGTTCGGGGACATACAAAAAACGCATGCGACCGCGGCTTCGGCCACATCC
ACAAGAGGTTCACCCGGGTAGACTTCTGGACTGTGGATTCCGTCGTGGGGAATGTTACTG