Description :
From Genome Similarity Track
Location :
Scaffold_1811:1685- 3495
Sequence
1810 bases(100 bases per row)
ACACTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGACAGTAAAGCTGCCCACTGTCCCAAAC
GTCCTTGTAATCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAA
CACGCGCAGGGGCGCGAGTATCTCTTTCCCCACCGCTCCGTAGTTCAGTTCATTTGGCTTCAGGGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCT
TCATGTTCTTGTACCAAAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGG
TCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTACCCAGACTGG
ATCATCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGG
GCCAGAGCTTGTTGGATTTTGTTCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAAT
CCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGTATCGCCCGTAACGACTGCGGGAAGGGCAAATTGGCTAACGAAGACAGGTCCTT
AAGATTCGCCCTCCCAATCCCTCCTTGGAACTCGATGGCCTAAGTAATCCACCTTGCGTTATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCC
ACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAA
CACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCATTTTTGGGTTCCGGTATTCGG
GTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTGGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTG
TATTGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAAAAACCGCTGGCCATGTCTAGAGAGCGGTACCAGAGTACTTTATCCAGATC
TACCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTC
TTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAGCTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTC
GGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATT
ACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCA
ATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTT
GTTCATCTTC