Description :
From Genome Similarity Track
Location :
Scaffold_72:168496- 169638
Sequence
1142 bases(100 bases per row)
GATTGCTGGCAGATTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTCTGCCAACCCAAGATGAACTTTCTGTCGCATAAAATTTCGCCAG
AAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCTATCACCGAGCTTTCGTTTCCAACGAGTAAGAAGAGCATGCAGTCGTTTCTTGGAGCAGTTAATT
ACTACAGCCGCTTCATTCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGTCGTTGAAGGTGGCCTTTCTGTGGCACG
TCGTTCCTTCGAAAGATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCACGTCATGCTCTTTGCGAATGAA
TGGGCGTTGAGCACTACGCTAATGCAAGAACATGACGGCAAGCTACACCCCGTACGGTTCCTCGGTCGTGTGCTCAAGGAAGCCGAGATGAACTACCATC
CTGCTGAGAAGGAAGTCTTGGCGTTACTTCTGCTGTTGAAGATATGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACACGATTCTCGACGTT
AGAGTGGGTGCACAAGTCGAAATCTCTGTTCGGACGCGCGGTCCAGTTCGCTGTGCTGCTTTCGCAGTGGCATTTGAAGGTGCAGCGCGTGAAGGAGAAG
GATGTCGCCTTCGCACAGCTCCAGCAGTCAAGCAACACGAGCTTCGTCGACTTGGAAGACTTACTCGCGCCGGTGGCACCTCCAAACAAGGGCTCTCCGA
CTATTCGAATGGACCCCGCGTTGCTGTACGCCAGGTTTCCCGGTAATTACAGCGGATTCGTCATGTCTCTTGACGGATCAGCGAAGACAGAGAGGTACGG
TGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCTACCACGGTGAATGAGGCA
GAGTATAAAGGTATGGTAAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGCGATTCAACAATCAC
TAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGC