Description :
From Genome Similarity Track
Location :
Scaffold_53:16849- 19788
Sequence
2939 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCATCCAACGACTATGAACATGTTGGATGATGAAGCGGAAGACTTCCATCCAACGACGAGAGCTATTCCCAT
TTGAGTCAAATCGAATGAGATGCTGTCGAACGCTTAAGCTCGACGATAGGGCAAGAAGCCGTAGGGGCAATGCTGTCCGCTCTGGGTCCAGACGGGCAAC
TCGCCACCATCGCCAAATTCATTCAGAATGAACTTGATGCTAAACGGGGAAAGTAACCTTGCTTCACCAACAAGGGTCTCAATAGACAGAGCTGCTGAGA
GAACAGCGTGATCAACAGTTCGAGTTGTTGAGACAGCAGCAGGCTGCTGCCACCGGGTCGACACACTCACGCCGACCCGAATCACTGATGATTGACAGCT
CCAAATACAAAGCAGCTGAAGAAGATTCTCTGCTGAGATGGTTTGTTGAGCTAGATGACGCCATAAGGGCTCGTTACATCGTCGACGAGCAAATGCATGT
CGCATTTGCTCAGTTGCACTTGGCAGGGCGTGCGTAGACTTGAGCCTTGGGCCTCAAGCTACACGACTTATTTGGATCGGGTCGTTATAAGTGTTCAAGT
CCCTGCTTAGGCAAACATTCAAAACACTGAGTTCAGGGCTCTCTATGAACTCCTGAAACTCAAACAAGGCAAACGTGATGTACACTCGTACATTCAGTAC
ATACGACATCTTACGAGTTACATCACAGCAAATCCGCTGAATGAACAAACGTTGATCACGTTGTTCATGTAAGGCCTCACGGACGGTCCAGTCAGGACCT
ATCTCTTTCGGTTGAAATTTGATACCCTGAAGGAGGCAATCCGGGTTGAGGAACAAGAAGATTTCAGCGTGACACAAGCTCACGTGGGTTCAAACTCCTA
TCGTCACCTCGAGGCGACAGGAAAACGGAGGCTCATAACCGACGGACCTCTGTTACGCTGAGCACTCAAGTCCTCCCAGTATTAATTATAAGAAATTGCA
GACATGCAATAGGTGTCAAAAACAGGGCATTATGCATACGAATGCAGTGCCTCGAACGCGGTGCCACATACTGCAGGAAACATTCACCGTCAAGCGACCA
AGAAGGGTTCAACGCGTGGGTCCGAAGCTGTTGTGAAAATGCAACACCGGAACAGACAGTCGAAAACGTTCGGGTTTAGTAGGTGCAGAGTACCCTACTG
ATCCAGAAACGTCAAGTGAATTTGCAGGCCTCTCAACGAGATTTTCTCCCAACACGCAATCATTGTGTGTTACTGCATCTGGTAATGAGGTTTCCCTCAC
TACCTTGAAGCTCGAAGTGGCAAAGGACATGTCACTATGAGCCCTAGTCGATTGTGGAGCGTCGAACAACTTTGTACGACGCCAGTCGCTTGATGAAAGC
AAGCTCAATTTAATTAAGCGCTAGATCCCTCCAACGGGAATGACTGTAGGCCTCACTACACGCGCATCCGTAATAGCGCAGAACCGTGTAATGGGAATTT
CCTATACACTAAAGAAGTCCAATACGATGAAGAATTTATATCATTGGACTTGGACGACAAGTTTGATGTCATCCTCGTTCTACCGTGGATCAGAAGGTAC
GAGCCACAAGTCAGCTGGCATCGACGAAGTGTCGATATGCCCGCCGCTTTATCACCAGACGCCCATCTGATGAACGTCTTGGAGCGTTCACCACCATGTG
GATGTACTACGATGAGTGCGATGGCCTCATGTGTGGTTCGGTCATTAGTACGACCGCACAAGATCACAATATGACTAACCATCATAGTGCGGAGAAAGAT
TTCTAGGACTGCATAACAATGCAGGAAGCGCCGAAGGCCCACCTCTCGGAAAAGTCGATTGGACTGGGGCATATTTGCCTCCTTAATAGACAACACCCGG
ATCATGACCAACCGATTTCCAATGATGATCGATACAAAGATGGAATATCCCAAGAGGCTAGAATGGAGGGAATAAGTCCCCAGCAAACAGTGGAAGTAAG
TTTCCATGAGATAATAGAGACATTGAATGTCCTGGTTAATGAAGGATCAAGCATAGGTAGCCATATGCTTGATCTGATCGCGCCTCCAAAATTAACTTCG
GAGATCACTCAGTTACCCCCACTGAACCAAAGATTTTCTTGCGTGATCTGCGTAGTAGCAAAGTCAAGCAGACTTGCGTACTCGTCGCGGAGGATGAGTA
CGTCAGTGATATCCGATCGGCAATGGTCTTTGCCGAAGATGAAGGAGTTCTCAGTAGCTCATTAATGGACGAGGGTGTCCTCGATGAGAAGACTCGAATT
GAGCGATATACATCCCAATCGTGGGAATTACCCAAAGCAAATCCTCTCTACGATGATTTGATGGAACTCAGGGATGTATTCCCAGAAGCATTGTTGTGCG
AGTTACCTAAGGACAAAGGTACTCGCCACAAAATCGACCTGAAACCGGGTTCGAAGTACTATGTCATGAAGCAATGACTGCTGCCTCGTGAACAAGTACT
AGCGATCGACAGATTCGTTGCAGATAGCTTTGTAGCCAGCCATGTGAGGGAGTCCACCTCTCCACATAGCTCTCCGACCTTCTGTGTGCGAAAGGCCAAA
GGAGGGTGGCGGATAGTACACGCCTTCAACAAGTTAGATGCTGCCACTATACCGGCTCAAACACCAATACCAAGAAAAGATGTCATCATTGATGGTATGG
CAAAGAGTGCCATCTTTTCATCCATGGATCGAATGGATGGGTTCTATCAGATCCTTGTGCGCGAAAGGGACATTCCCCATACTGCAGTGAGCACCCAAGC
AGTATGCTTTGAGAGTGGCTAGTAATGCCACAAGGGCTAAGTAATGCCCTTCCAACATTCAACATATGTGTAATGAATCTATTAAGATCCGTACGATAGT
TCGCGCCCAGTTACTTCGATGAGGTGTTCGTTCATAGCC