Description :
From Genome Similarity Track
Location :
Scaffold_8:168449- 169551
Sequence
1102 bases(100 bases per row)
CAAAGGCGAGCTCCAGAGCTTGCTCCCCTATCTTATTTTTTACGAGCCCAACGGGTAAAGCAATTAGTGACTGGCGCAAAGCGAAAATTAAAACATTTAA
AACTTAACTTTTGTCTGTGCGTCTAGGTAAACTTTACCCATTGCACTATCTGCAATTGCGCCTGTCCCCCTCACAGGTGGACATACATCATAGGTGCAGC
TCTATGTAAGGTCACTATGTGCGACCTCTTAGAGAGAGTAAGTCACATCCACAAGATGAGGTAGAGAGATGAAAAAGCACTTTTTATTCGGAAGAAGTTT
ATTTCTGACACCCATCAATGATCAACAATGATTGGCTCAAAATTTACTTAAGGTAGAAAGAGGGCTAACAAGCAAATGATCAACACTTTTTAAGGCGAAA
GTCTTGCACCTCGCAAAAAAAGTATATGTGAAGTGAATTCTATTTCAGTTGCCTCATAACTCAGACATTAAGAGTAATGGTCACATATTTTGTGTCGGTA
GGAGAGAACCTCCCGTATCTTCATTTTCTTTTTCCCAAATCGATTATTTGTCGTCAACTGCCCTTTGTTGTTGACAGCTTTACCGACAAGGATCAATCTC
AGTCTTACCTTTTTCATATGCGTATTTTGAACATCAACAACATCAACGAGTATCTTTAGCACACACACACAATCCATCAATACTTTCATTATAGAGAACA
ACACACACTACCCATTTCCTAGTCGCGATATTGTTTTGAACCTAGGCAAAGATTGACATCTAGTATACCTATATACCTATGAGGGGGTACAGGTTAGATC
GCACTTAGTACGTGTAAGGTACACCTAACTGCGTTATTTACAGACACACACAGACAGACACATCGATAAGTACGATTTAATAAGTTCGGCATTCACCTTG
GGCTTAGTCACTAATAGCTTCACCCTTCGTATCACATAAAAATTTGGCAAATACTAAACGGCAGGGTTCATTTTTATTTGGCTGGGTATTCTGATTCGTT
ATTGGAAGTTCCTCAGGTGTACGCTCAATTTCGTCAGGAGTAGATCCCAAGAACTCAATTCACCATTATTGTTTACTCACTTGCCTAGTGCAAAGCTCAA
AA