Description :
From Genome Similarity Track
Location :
Scaffold_363:16844- 18310
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_363-fgenesh-gene-0.4Dicarboxylate/amino acid:cation

Sequence
1466 bases(100 bases per row)
CCTCTGGGACACCATCGCGATCCGCCCCGTCGTGACACAGATGGTGTCGCGCGGCTACTTGACTCAGGACAAGTACGACAAGATGCGCGAGTCGCTCTGG
AAGAACGCGGCCGTGGGCTCGTTCTTTGCGTTTGGCCTGTACATCGGCCACGACAAGGACTGGTTTATGACCCCGAGCGGCTACTTTTCCGATTTCCCCT
ACACGACACCCGAGATCTTGAAGTGGTACTACATGATCTACCTGTCGTTCTGGTTCCAGGGCATCGACTTCATGCTCAATATCACGAGCAAGCAGTACGT
CGTGAAGCGCAAGGACAACGCCGAGATGCTGCTGCATCACTTCGCCACGATCGCGCTCATGGTGTTCTCCTACTACTTTGACCTCACGCGCGTCGGTATG
TGCGTGCTCATGATCCATGACGTCAACGACTTGCTCCTCGAGACTGGTACGTGCTTTGTATTATCACGATTGAGGCGATGTTTTACTGTTTATTTGACTG
TGATATGATGGGCTCATACGTTTCATTCGTATTGCTTGGAATGACAGCCAAGGTGTTTGTGTACATGGAGAGCGAGTTGCTGGCGAATATTATGTTCGGC
ACGTTTGCGGTCGTGTGGTTCATCGTGCGCTGGTACTTTTACTCGAAGAACATCCTCTACTCCGTGTACACGCTCGGCTGGGACGATATCGTGCAACCCG
CGATTGAGAAGGGGTCGCTCCACGGCGTGTCGGCATCGAGCTGGTACTATCTGTGGGTTGTCTTCTTCGGCTTCCTGCTGCTGCTCTTGGTGCTTCACGT
CTACTGGGGCGTGCTCATCGTCAAGATGGTGATCAAGGCGCTCGGTGACGGCAACGTGGAGAAGGATATCCGCAGTGACTCGGAGGACGAGGGTGAGAAG
GTCATCGAGGACGCGAACGAGGAGGACGAAGACTCGGCGTCGGATTCGGCGTCCGCTCCAGTCGCGAATGGCAAGCCAAAGCGCCGCCGCGCGCCAAAAG
CCGAGTAAGTAGCATTTCGAATGAACGAGAGCGAGTGAGTGAGTGAGAGAGAGAGCGAACAAACGAATGAATGGTGAGTAAAAGGCAAAGACGATGGAGA
GCACCAGTAGGTAGGAAGCAAAGAGTAGGAGAGGACATACGTTTGGCGTAGCAGAGTAGATTTAGAGCCGCCACCCTGTTCCTGACAAGCCCCACCGCAA
CGGTATGGCGCTGGTGGTCACACTAGCAGCGACAGTAGTAACAGTAGATAACGAAGCAGCACAGAAGTGAACGCATGAGTAATCAGTTCCCGTTCATTTT
GAGCTCTCCATGGATACTTCTCTCTTTTTTGTTTTCGCTTAACCGACACTTTTGGTTCTTCTTAGTATCAAAAATGTCGGTTAATTGAAATATATTTTCC
TTCACAAGTCGATACAGCGCCGTCATACCGGGTTTGAAGGGGAGCTCTCCATTTCCAATCGGACAA