Description :
From Genome Similarity Track
Location :
Scaffold_15:168438- 170997
Transcript NameFunction/comments
Hyaar_Emoy2802787alpha,alpha-trehalose-phosphate synthase
Hyaar_Emoy2802788nucleolar protein Nop56

Sequence
2559 bases(100 bases per row)
GTACCCTGACGCATTGTCCTGTTCACTACATTCACCAGCCAGTGGCTCCCAGTGAACTGGTTGCGCTGTACAACCTAGCTGATGCTTGCCTCGTGACGTC
CATCCGTGACGGTATGAACCTGGTGAGCCATGAGTACGTGATTTGTCAGTGTCAACCGTGCGAGCCGCATCGGGAAGGGCCGGGCGTGCTCATTTTGAGC
GAATTCGCTGGCAGTGCCCAATCGTTATCAGGTGCGATCCGTGTCAATCCCTGGAACACGACGGATGTGGCCAATGCACTCGAATATGCTCTGGAGTTGC
CGCCCATGGAACGCGAATATCGTCAAACGAATCTGCACCGCTACGTGAAGACGCACACTGCTAGTTTCTGGGGTCGAAGCTTTTTGTCCGATTTAGAGGA
CGTCGTGTCGCGACCGAGGACCGCAGCCAAAAATTAGAGCGTGTGCCGATTTCGACGTGCAATAATGGTGGCCGATTTCTAACGTCAATGCGCTTTTTAC
TACGTTCTTACGTGAATCGACGTTGTTTAGCAAACGTGCGTGGGTAGTAAATGCAAGTTGGCATTGTGGTAGTAGTAATAGTAGTAGTAGTAATAGTTGT
ACTATAATCTACCACGGTGCGGTACTATTCTGTCTTCCGATCATTCGTTGGCCGAAAATGCTGCCCATTACCTCCAATCGTTTATCGTCATTCCGCACAT
ATCAGCCAATGAAGTGTAGAATCAATCTGGCTGGCCAGCAGTCACTGACAGCCCCGCGTTGCAACCCCCACCACCACCCACGAACAGTTGGAAAACACGG
CAGTCAGGACGAACATGGTAAGTGAACGACAAGGTGTTGCTTGGTTGGCGGTGCATAGCTGTAGTTGTGTTTCACTGTTGAATGTACAATTTGCTCGACG
CGATCGCTGCGTTTCCTGTGAGTACGACATACTCACTATCATTCTCTTCTCCTAACTATTCCAAATAGGGGGCCAACAACTTTGTGCTGTTTGAGTCGGC
TTCTGGCTATGCGCTCTTCGAGGTGGTGGAACATGAAGAGATTGGAAGTCTCGTGGCCGAGGTGCAGGCTGCAACGGCTGACGTGTCTTCGTTTGGACGC
ATTGTGAAGCTTAAGGCGTTCCAGCCCTTTACGTCGGCCGAGAATGCTCTCGAGAACATTAACAATGTTTCGGAAGGTCTGTTAGGCGAAGATCTCAAGA
ACTTTTTAGAGATTAATCTACCCAAGGTCAAGAGTGGCAAAAAGGGCAAATTTGCGCTTGGCGTGCAAGACAAGGGGCTCGCGCAGGCCATTTCGGACGA
GTTGCACGCGCCGTGCAACACAAGCGAGACGACGCTGGAGATTGTTCGAGGTGTGCGTATGCACTTTAGCACGTTTGTCAAGGAACTGGCTCAGGGGAAC
CTTGCAAAGGCTCAGCTTGGTCTCGGCCACTCGTACTCTCGTGCCAAGGTCAAATTTAACGTGAACCGTGCCGACAACATGATCATTCAGGCAATCGCTC
TGCTTGATCAAATGGACAAGGATATTAACACGTTTGCGATGCGCGTGCGGGAGTGGTACTCGTGGCACTTTCCTGAGCTGGTCAAGATTGTCAATGACAA
CTATGTGTATGCGCGCTGCGCTTCATTCATTAAGAACCGCAACACGTTGAGCGAGGACTCGCTCGAGAAGCTATCGCAGATTGTTCTTGATGAGGACAAG
GCCCAGCAGATCCTGTATGCTGCTCGCTCTTCAATGGGCATGGACATGTCGGAGATCGACATGATTAACGTTAACAACTTTACCACTCGTCTCATCAAGC
TAGCAGAGTATCGTCGTCAACTGCACGAGTACCTGGTCTCCAAGATGTCGTCGGTAGCTCCAAACCTTGCATCACTTATCGGCGAGTCAGTTGGTGCTCG
TCTGATCTCACACGCTGGTTCGCTGACCAACTTGGCCAAGTGCCCGGCCTCAACTGTGCAGATTTTGGGTGCTGAGAAGGCTCTGTTCCGAGCATTGAAG
ACCCGTGGCAACACTCCCAAGTATGGATTGCTGTTCCACTCGACCTTCATTGGCCGTGCCGCATCCAAGAACAAGGGCCGCATTTCACGTTACCTAGCTA
ACAAGTGTGCGATCGCCTCGCGCATCGATTCGTTCATTGACGAGCCTACCACAAAGTATGGCGAAAAGATGCGTGAGCAGGTTGAAGAGCGCCTTGCGTT
CTACGAGAGTGGCGCTGCTCCGCGCAAGAATGCCGACGTGATGCAGGAGGTTTCGGAAGAGCTTCAGCTAGCTGCTGCAAAGGGAGACAAGAATTCGAAG
AAGGACAAGAAGTCGAAGAAGCGCTCTGCGGTCGACGGCGATGGTGAAATGGAGCAAGTCATGGAGGAAGCGGCTAGTAAGAAGTCCAAAAAGGCCAAGA
AAGACAAACAGCACAGTAAAGTGGAGGAGGTGGCGGCTGTTGTGGCGTCTGTCGCTGATGCTGACAAGAAGAAGAAGAAAAAGCACAAGAAGAAAGCCAA
GACTGCGGAGTAGAGTGCAGCTCCTCGACACTAGCAGTTGTAGTGCACTTACTCTTTTT