Description :
From Genome Similarity Track
Location :
Scaffold_92:168425- 171586
Transcript NameFunction/comments
Physo_121502hypothetical protein

Sequence
3161 bases(100 bases per row)
GAAATACATTCAGTTTGAGATTCACACAGTTAAGAGTTATTGTGAAAACCGATTAGTTTGTCCTGCTGAATTGGCCAGTAAAGCATCACTCACAGAGGAT
TTAGAGGCTGCTAAATCGGGGATGTCTCAATCATAATCGGAGTATAAATCGTTCATCGGTCTCGTAATTATGTGCAGCCTAGCAATTTCGATGTACTGTA
ATGTACTTCGGCCGGAGACTCGCCAAGTCCATCGGCAACACCGCGTCGCCTGGATATCTCAGTTACATGTATTATAGCGTGCGGCTTTTCCTGCTTAGTT
CTGATGTTAGTGTTGTAGCCTTGACTACCTAGCCAAGAGCGACTGCAGCGATTGTTGTCTGGCGGCTGATTTAGCCTACAAGGAGCGAATGCCGGTCGCA
CATCGGACATTCCGTCTGAATAGCAAGCAAATCAGCCGGCTCTGGCTTAATCGGCCGATTAGCAAATGTAAATCCGGCTCATATGCTCTGATTCTGCAAG
TCGTCCTAGGTTATAATCTTGATTATAAATCGAGGTACCCCAGTCTAATTAGGAGGTCGGATTTATCAAATCGGGGGTCGTCGGTCTTATTAAGCCACTA
AATCGGCGGATTAACAATCCGATAAGACATTCTAATCGGTTTTCACAATAAGGGTTGACTCTTGGAGTCCGTAAGGTATACGGACTCGTACGTTCCGGTA
TTTGAACGGTCTATTTCAAACTGAGACTCTGTGAGTCTGTTACGCCTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCAAAAAAAATACTCTCCACT
TGAGAAAAAATTACTTGCACAACGGTAGATACCCATGCGCTTAAAGACGCTCGAATCCGCACAAGACCCAGGGCAACCACAGTACACAGCAAATATTCAC
TTGTCATTATCGCAGACCAACTGCATTGCTACTAAATATCTGTTCGTCAAATGTTGCATGAAGAATACGAACCTATTAGAGAAAGATCAACAGGCAGATA
TTATCACATTACCGTTGCTTACCTCTTCTTCCTGTCGAAGTAACTACTGCCGTCCACTGCGGGGCGTTGCGAGAGGGGCAGCGTTGTTCCGTCGATAAGC
CCACACAATCAGGAAAGCAGAAGCGACCTTGTGTTGCTCACAGAGTAGGAAGCTCAAGGAACGAGTAGTCACGAGCAGGCAGCAAAGGCTACCTGTGAGG
CAGTCGGTGTTTTGTGGAAAAAATGAGCTCAAAGCTCCCGTTAGTTCTTTCCTGCTCTCTGTAGTCCTTCTTTCCTAACTGCCGGTTGTGGTGGTCAACC
TTTTTCATAGGAAAGCCCGACCACGTGGGAAAACCTCCAGCACTCTGTGCCTTCACAGGATAAACGACCCACGCTCGCACTCCAACGTTGGGATCAATAC
ACATCAATCCTCAACAGCCCCACCTAGTGGTCTCCATCGTTGCATTGCGACGCGTCGAACGCTGCTCGCGGCAGTACCCCCATTGCATCTCTGTGTTTCT
CAAACGTGCTTCTTGACAGGGTTTTCGTGAAAGCGTCTGCAACATTATCCACGCTTGACTTCAATCTCTTTCAGATCCACCGCTCTCGAACGAAGTGATG
TCGCACATCGATATGCTTCGTACGATTGTATCGCAGGATTCTCCGCCAACTTCTTGGTGCTCTCATTGTCAACAAATACTTCTGTAGGGGCCTTTTGCAC
CATCGTCAACTCTTTCAGCATTTGCCGTAGATGAATCACTTCTTGTACAAGTAGGCTCAAAGCCATGCACTCGGCTTCGGTAGTGTGAAGAGCCACTGTC
TTTTCGGTCTGACAACTCCACGAAATAGTACTTCCACAGAACTTTGCCAGGTACCCTGCTACCGATTTTCTATCGTCCACTCGATTGGCAAAGTCGGCAT
CAGCGTATGCCTGCAAGTGTCGGTCAAGCACTTACTCAGTCCATTCAAGCCCTCCTAGACGAAATCCATAGTCGACTGCCTCTCGTAGGTAGCGAAGGCC
ACGCTTCGCGGCTCGCCAGTGCGTCAAGCCAGGATTCTCCAAGAACTGGCTGCACTCACGGACTAAATACGCCAGGTCGGGGCGACTTCCCAGCATCAAA
TACATCAGGTTTCCAACTACGGACCGGTACGGCTTGCTCTCCATAAGCTTCCGTTCATCATGCTCCGTTGGACACATCGTTTTCGTCAACTTCAAGCCTG
GCGTGCCTGGTGTCTTGCATCCATTGCACTCGGCCATACCAAATCTCTGCAACACAGAGTCACCATACTTTCTTTGTCCAATGAAAATTGTCCTCTCTTC
ACGGTTTCGGATGATCTCCCAACCCAAAATGTAGTGATGCTCTCCAAGATCTTTCATCTCGAAGCGCGAGTGAAACATTTGCTTCATCTGGTTGATAAGA
TCCATCGTAGGAGCGAAAAGAATCAAATCGTCCACGTAGAGAGGAATAAACACTAGTTGACAATCAATCACTTTGACTGCAATGCAAGCCTCCGACTTCA
ACATAGTAAATCCTTGCTCCTCCAAAAATGACTTCAGAAGCTGGAATCACACTCGTGGAGCCTGTTTCAAGCCATACAGGCTTTTCAACAAGTGGCAAAC
CCAGTCTTCCTTGACCGGCACAGCATATCCCTCGGGCTGCTCCATAAAGACCTCTACATCAATCTTTCCGTTCAAGAATGCGGTGGTGACGTCCATTTGG
CGCACTTCATAGTCCCAGACGGCGGCCAATGTCAACAGGACTCGCAATGTTTCGAGACGCACCACAGGCAAGTAGACTTCTAGATAATCGACTCCATAAA
TCTGCATAAACCCTTTTATAACGAGTCTTGCTTTGAATCGATCTATCTCTCCAGATGCCAGATATTTGACACGAAACACCCACCGGTTCTTCAATACCTT
CATGTGCTTCTTTCGAGGGACAAGTTCCCACGTGCCATTCCGCACCAATGCATCATATTCTACGTCAGACGCAGTCCGCCACTGCAGGCAGTGCTCACTC
TCCATGGCATCTTTCATTGTATCTGGCTCCGTAATTACACTCATGGTCAGGCAGCAGTAGTCCTGCCACCATGCAAGTGCGGTTTCTTTTGCCATCGTCC
GCTGCAGCTCTTCACGAGCTTTCGACCATTCCACTGACGACAAACCCACAGCGATATTAGA