Description :
From Genome Similarity Track
Location :
Scaffold_91:16842- 18244
Transcript NameFunction/comments
g15176.t1hypothetical protein

Sequence
1402 bases(100 bases per row)
CGGGTCTAGGAACCAGCGCTTACGAGCCGCTGGGGCAGCTCCGATGGCCATTTCGTAGAAAATGTGGTAGTTCCGCTCGCCCTTGGACTGCGACACGAGA
CGCACCTTCTCGAGCAAATACGTCTGGATGCTGGCGCCGGTGAGTCTCCCGCCGCTGGTAAAATGCAGCTTGATAAACTTGCCGAAGCGACTGGAGTTGT
CGTTGCGTAGTGTGCGCGCGTTGCCGAACGACTCGAGGAGGATGTTGGTCTGCAGCACTTTGGCCGCGATGCCCTCGGGGCTCTTGCCCGCCACGGACGC
CGCCAGGTTGTTGGCGCCTACTTGGGCGAGATACTCCATGAGGAACTTGGTGCTCTCGGTCTTGCCGCTGCCGCTCTCTCCACTCACGAGGATGCTCTGG
TCGCTCATGACTCCGTTGAGGCCGAGCATCATGGCCTTGTAGGCTTCTCCCGCGACTTGGTAGATGTGCGGGGGCATGGGCTCGCTGCCTTTGTTCCTGA
GGGACGAGCTGCGCGCCTCGAAGGACAGCAGGTACTTGGCCATCGTGTCTTTACTGTAGATGTTGGGGATCTTCTGGAACGGGTTCACAGCCAGCAGGAT
GGCGCCCGTGTTGGTGTAGATCTTCTGCTGGGCGAAACGCGTGTCCAAGGCGCTGAGGATCGACGTCTCGTCCAGCTCGATGAGCGTTGTGAGGTCGTCC
ACGTCCACATCCTGACCCTGAGAGAGCAACCGCACGTCGGGCGCGTCCTGCGTCACGTCCCCGGAGACGCCGCGCTCGACCACACTGCCGTCCTCGAACT
GGACGACGACTACGGCGCCCGTGAGGCTCGCGTAGCGTTCCACGACGCGGCCGCGCCGCCATTTCTGCGGCGCTAGCTGCACTTCCACGTCAGCGCCCAC
GTCCATCGCTGCGTCGATTGGCCTCTGCCTGCAGCTTCCGTCACCGCCGCCGTCGATGGGAAGGTGGGGGCGCTTTCTGCGAACGCTGGGCCGTTACCGC
TCGGTCGCAGATGTGAACACCAAACTCCTCTCGGCGTTGCCCTGAGCACACACAACCCTGCGACCAGCTTTTGAGGCAGGGTATAGTGAAACCAAGTGAA
AGATGACCCGGCCATATGCATGACCAGACGGATGTAGTCAGTACAAACCCCTCCTTTGTGATATGTGCAGGGAGCCAACATTTTATTCCTGGTCAAAGGT
ATTCCTATCGCAGGGTGTATTAAATACATGGCAAATACCTATGAAAGACCCGTATGATACACGTTTTGCATTGTATGTAAATGAGAACGTCTCAATAGTA
ATGTACGTCAGTTTCAGCGCTCTGATATCCCTGTTGAGAGAGTATTGTTATCCTGGGAATTACTATGGAGAGGGGTGCCTGTACATGTACTGTACGGTAC
CT