Description :
From Genome Similarity Track
Location :
contig_113:16840- 19335
Transcript NameFunction/comments
g13260.t1hypothetical protein

Sequence
2495 bases(100 bases per row)
CCACGCTTGTCGGCGTTCTCCTTCTGCTTATCCACTGCTTCTTGCAGTGCATCTCGTGCAAATCGGGTGACCGATTGTCGCTGCAGCACGAACTCAGAGA
CGGCCGCATCATCGACTGGACGCGCCGGAGGCTTCGGCGCGTAGTTAGCTGCGACGGGATCGGTAGCCGGGCCAGGGTTGATTAACGTGCGCGCAGTCCA
ATCTGTCAGTGAACACACCGCGTTGTTCGGCGTCGCAAGGGTCCGTCTCGACTTCGCGCGGGTGACTGCATTCAGCGTCACGGACTGGTGGGCTGCACTC
GACAAGGGAGCTGGTGGTTGTGGTGTGCCATCCGTGCTCACCACTGGTAATACCGGTATCAGTATCGGTGTGTCTGTGTTCGTACTACCAGCACCATCAT
TTCCTTCCCCACCCAGAGTGGAGCCACGAGGCATCGTGGGGAGGCCCACGGCGAGCAGAGCGGGAACGCGCGGGTGCCGCGCGTTATTTACAAAAAAGGG
GGTCAGACCCGTCGATGCGTGTTCTGCGTTGTTTAGCGCAAACTCGGCAAGCGGCAAAAAGGAGCTCCAACTAGTGAACGAAGTCGCGTAACTTCGAAGG
ACATCTTCGAGGACTCGGTTGACCCGCTCCGTTTGACCATCCGTCTCCGGATGCGCCGCCGTTGACATGAGCAGCTTCGTTCCCAGAAGTTGGAAGAGAC
TCGACCAGAATGCCGACGTGAACCGCGGATCGCGGTCAGAGACGATCGATTCAGGTAAGCCGTGGTGTCGAAAGACCGCGTCAACGAAATGCACCGCGGA
CTCAGCCGCGGTGATCGTGTCGGACACCGGAATGAGATGCACCATCTTGCTGAACCTATCCACAAACACCAAGACGCCAGTCCGACCGTCGGCATCGGGT
GGAAGCCCGAAGATGAAGTCCATCGACACTGAGCGCCACGCCTCAGTTGCAATCGGCAGGGGTCGCAGGGGAGCCTGCGACGACTTTGACGGCTTCACGC
GCTGGCAAATCTCACAAGTACGGACCCACTTGCGCACCCATTTGTACATGTGGGGCCAGTAGAAGTCGCGGGATACTGCCGCGAACGTCTTTTCGCGGCC
CAAGTGACCACCGACAGGGCTGTCGTGGAACTCGTGGATGATCCGAGCGCGCAGATCATCGTCGTTCGGGATGGCGATGCGGGGAGCATCGAATCGATCG
ATGCTGTACGTCAGCAGATCGCCGTCGAGTTGATATCGGTTAATCTGATTGCGCGTGTTGTTCGGCAGCGCGTGGAGTGTTTTATCACTGGGGGAAAGAA
GATGTGCGAGGATGGCGGCATATACCGCGTCGTCGTTGTACGCAACGGCAATTTCTTCGCGTAGCGGCATTTCTGGAGTCACGTTCATCAGGTTGACACC
TGATGTCAAGCACATCGCGCAGTGATCTTCGTCATCCTCGTCTTCGTCAATCACTTGACGACCCCGCGTCGCTCGTGGATCATAGTCTGGACTCCGAGAC
AGAGCATCGGCGAGGATATTGTTCTTGCCGGGCTTGTAGTGCACGACGAAGTTGTACTCAGCGAAGAACGACAGCCATCGTGCCATGCGTTGAGACAGAT
GTGGAGACTTCATCGCTGTGCGCAGCGATGCGTGATCCGTGTACACCGCGAACGTCTGTTCTCCGAGCAGGTACACTCTGAATTTGATCAGAGCGTATCG
CATCGCAAGAAGTTCCTTGTCGTGGACGGGATAGTTGCGTTCGGCCGGCTTCATCTGTCGTGATTGATAGCTCACGACTAGTTCGCGGCCTTCGTTGTCA
AACTGCGTGAGCGCGCACCCGATAGCAAAGTCGCTAGCGTCGCAGACGACGTGAAACGGTTTCGCGTCATCTGGGAGCATCAGTATTGGCGCCGAGGCCA
AGCTCTTCTTCACCGAGTCGAAGGCTACTTGATGCTCGGGGCGCCACGACCACGTGGCGTCTTTCTTCAACAGCGACGACAGTGGCTGTATCAAGCCGGC
ATATCCCTTCGTATACTTGTGCAAGTAGTTAGCGAGGCCCAACCACTGACGCAGCTCAGTGGGGTTTGATGGTGGTGGCCACGAGCAAATAGACGACACT
TTTTCCGGGTCAGCACGGACTCCGTTTTTGCTTACGTAGCACCCAAGCACCGGAATTTCCGGCGCGCAGAAGACACACTTCTTGAGATTCGCGTAGAGCT
TGTTCTCTCTCATCACTTGAAAGACCTGCCTCAAGTGCCGCAGATGCACGTCGATCGCGCTGAGACCCTCTTCAGCGTGACTGTGCACAAAAATGTCATC
GAAGTAACTCGGAGCGAAGTCACGAAGCGGGCGTAGCACATGGGACACCATGCGATTAAATGTGGCTGGTGCGTTCTTCAGACCTTGGGGCATCACGAGC
CACTCCCAGAGCATACCGCTGGGCGTACTGACTGCCGTGAGAGGTACATCGCTCTCTCTCATGAGGATCTGATAGAAGCCATCGGTCAAGTCGAT