Description :
From Genome Similarity Track
Location :
Scaffold_272:16839- 19320
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_272-snap-gene-0.10RCC1 and BTB domain-containing protein

Sequence
2481 bases(100 bases per row)
AATTGCTTGGCGTATCCTTCTCGAGTTTTCTTGCTCTGTTGTATCAAGGTCTTGCGATTTGCTCTTGCAAGTGACTTCAAGATCGATGCCAAGCCCCACG
ATGCGGAAGAGGAACTCATTGGGCCAAGAGGATTTGTTCTCAGATACCAAGTTTCATGAGCGTATCTCGTCTGCACTGGGACGATCGATTGTTGGACAGC
TCCTGCCTGGTTTAGTGGATGCCTTGCTCTCGTTTGCTCACCTTCCCGTGTTTGCTACCACTTTGGCGGAACCAGTAATGCTTTtATTGCGGATGATTGG
CGACTGGAACACCACACACGCAGATGATGAAaCATTGCATAaCGATGGTCGACCTGGgAAAgTCGGATCTTCTACCGCATGCCGAATTGTGAATCGAAAC
AaGTCCGAGAATGTACTCGTCACCTGCTCCAAGAATCCCACGACACTTGGTACATCGCGATCTGGAAAAAGCGAGGCAACTTCCTCAACAGGTCAAGTTC
CAATTGCTGAGGCACTTGCACTGCCATGGTCTCTCTTGCTTGAGAGGGAGTTGGCTTTGCTCTGTGCCCAATTCGTTTCCACTTTAGTGCGTGCAAATCC
ACTGATACAGAACAAGCCTGAAACTATCGATGACACTGATGATTTGTGGACTAAAAGCGAGTTGTTTACTGGTGGGTTGGAGCCCGATTTCATTCATCAA
AGCCTGTTTGAGAATGCGACAGAGACGGTCATCGCCCATGGCCCGCGTTTGAACGCAGTTACACCAGCAATGCCATTTTGGTCTGAGTTCCGAATCACAC
TACCTCGTCGTGAGTTTGAACTTGATGGTCAAGGATACCATGTCACACCGGACGCTATGGAGAATCACGTACTTCAATATCTCTCTCGGGTAAATGTCAG
ATCTTTCATATTGGGGATGGCCAAACCcATGAATGAAGAATGTGTTACCGAACACCAACGATTATCAAGATCTCTGTGTGGATGGGTTCgAGCATCATAC
GCAGCGACGGACTCGGCCTATCGTATGCTGCTGCGACAAGCTCAGATGCATCGCCAGCATGAGATGCAGCCAGCGTGCAACAGTGAAATGGATCTCGAAG
CTGCTGTTTTCGCAGTTTTATTGCATCACTACTCATACGGTTTATCAGCGTTTCTGACCAGTGTGAGAAGATCACGAGTCAACGCCGATCATAGGCCACC
ACGCtCCTTTCTcAACCTTTGGCGAGCTGTTGCTGGGTTCCGGAAACGATTTGTAGCAAAGAGGACATCAaTTAAAAaCGCAGCAGTAGACGCCGATTCA
GCACGTGCAAGCGTGCAACAATTCCAGCAGCTGGTGCTTGATCGATGCCAACTGCTACTGCATGTCCAAAATGCAGATGAAGAGCAGCATCGATTGTGTC
TTTTTGATGGCGGCTTCGTAGCTCCTTGGGATCCGGCATTTCTTCACTCTGCGTGCTCATCCACGAAGCATTCCAGCCAGAGAACTCCTCTACGAGCTCA
CATGGCCGCCGGTTATGGTGATGCATCTGATCAGCCATTCTTAGTTACCTACCCATGCACCCGCTGGCGACGTGTTCGAACACTTTTCCACGTCGTGCTC
CGCTGGAAAATGACTTGTTTACAAGGCGAAACGAAAACAAAAGCCGATGAAGCAATGCAATTTATTATGGCGGAAGATGCAGCACTGAAAGaTACGCTTC
AATTCGCCCATCGGGTGTTGATCGATCCATGTCGTCGGCTGAGCTGCTCAACACGCGGCCTGGAGTTAGTATGGGAGTTAATTCAGATTCCTCACGCCGA
ATCTGTGCGAACCACTCTGTTTCAACAACTGGCCCAATCCCTCGGCCATTCTCCACCTTATTCCCAAGTGAGCACAGCGCCATATGCGTACCAGGAAATG
TGTCGAAACGTGTTGAACGACCTCATTGCAGCTATAACGCAGTCGCTGGTAGACAAAGCACAAGAGATGAGTCAGTATCTTTCGATGGAGGACTCGGCTA
TTATGGAAAGCCAGTTCACGCGTCTGAGTATGCTTCGGTGCATGAGCCAGCTGCATGTCAACCTGCAACAATACGAATTTAtCAATGATCTTGGACTAGT
GCAAGTCCTCGATCACATGCTTCTCATGAGTGGTGACCAAGCTGCTGATCGCAATAAGGCTATTGGACAGAACGACAGTATCAGAGCCATTGCAGTACCC
AAAACCATCGTTAAAGAACCCCAAGCAGCTCACATCAAGGATGCACTGTGGGCGCTTGTGCGATCAGTTGTGCTCCACTTTAGTGCTTGTACTTCGTCCC
AAGATGGAACCGCTGTCACTCCTATTTATCCCGTCACACAAAGGGTGTTTGACACAATTCTCCGATGGATCCACGATCTTACTCATAGCAGTTCATCCAG
CCATAAGGTAACATCACCACCGGCAAAGGAaCAATTGGGGAACCTCGGGAGCTCAAGCAACGGTACTGTTCGTCGTAGTTT