Description :
From Genome Similarity Track
Location :
Scaffold_557:1683- 6948
Sequence
5265 bases(100 bases per row)
CAACCGATCAGCGTTGATTCCCCCAGTCCGGAACACCGACCACACGGTAGTCCCTCGCGAATATCCATGGTGGATTTATTTGGAGAGCCTTCAAGCGACT
CTGAAGGTGACCTCAGCCTCTCTGGTGATTCTCGGATTCGCTGTAATTCACTGCTGACTCCTGAGGAATTTTCGGCACTTCCTGAGACCCACATACCCCG
CAATCGTTGGATTCCGGGGTATCGCGATTGTATTCCGCGATCGGCAGTAGATGTGTCCCCTTGGTCCGCCCGGAGAGTGAGCCTGATCAGCGTATCCGAG
CTTGATCTAGACTTGTTCTATCATCACTTTTCAAAGCCCAAGGTATAAATCTTCCCGGTCCAACTGGGCAAAGCTCGCCCTCCTCCGGAGTCGTTCTGGT
CATCCCAGTTGATCACGTCGACCAAGATTGACCAATGTTACGATCAACAACCTTAGGACCTTTATGATCAAACCATACACCCGATCTCCTTCAAGCCTAT
CGGCTGGTTCGAAAAACTGGTCGAGGCATATGAAGGTTTCGTTGATAGCCATCGCCAAGCTCTGTGGGAATCGACCCATTTCTTGTTGATTTCCGCTGGG
CAGCGTAAAACGGATCCTGGATTGGCCGCGTTTGCGCTAGCGAGAAGGCAGAGGCGATCTCATGCTGGACCCCGTTGGAAGCGGTTACTGCAGCTGATTC
TTCAAGGGATGATCGAAGGTCTCTGCGATTTGGACATTTTACTGAACCCCATCTTTCTACGCTTTTCCCGTCCGAATGAGGCTAGAGTGTGGTATCCCGG
CCTTTCCGTGCGGCGGACCAACATACCCAACTTGATCACTGCCCTGTCGATCTATCACGCTACCTAGCGTTGGAGGAACCAGTTTTGTCCTTTGATCGCA
TCCCACCCTGGCTCATCTCTTCCACGCTTGGTTGGTAAGTTCTTTGACCGCAAGTAATTGACTTGGTATGTTCCATGACGCGATCTCTCAATTTACTTTC
TTCTCATTTCCATTCGATCGCTCCCATAATTCGTATTTCTTCCATCTTTTTTGTCTTTTCATCTTGATCGCACCGTTAAGTCTGCGATCGTCGCACTCAA
TTCACATAAATCCCATTCCATCTCCATGTGCAACCTCCTTGCACCCATAGGTCTCCTCCCCGTCTATGCACCGTCCCTGCATAGACCCATCCACTCAAGC
TCTCCGATCATCGCTATTCTCTGGCTTCTTCTTCGTGCGATTGTATCACCTCAAAACGATTCTTGCTCACCTGATCGCGATCGAACTCCTGCAACATAGC
TCCACAATTTAGATCAGCTTCGTCAATCCAAGTTGGGTCGCTGTACTCCTTCCGTTATACCAGGTACTGTTTGTGTATTTGGCCATATCTCGTCTTCCGT
CCTGATCGCACATCGATGATCTTGTCTACTTCAAACTCGTCCGCGTCGAGATTACCCTCCCAACTATCTTCCGGCAGCAGTACTTCATCAAAATCAAATC
GAGTCGCCTCATCCACATTTAATCCACCCGTTGGGCGTTATGGGAATACGCCAACTAGCTTCAGCTTAGACACGTGGACTATTGGGAATATCCGGTACGG
CGTGATCGCCGCACTTCTCGGCCACTCGAAAAGGTCCATGCCACATATGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTCCAGATATAGCCAAAC
GCGCGACCTGCGATCGATATCCAATAAATATCGATCTTCATTATGTCGATCGGCTTAACCTCTGATCGCAACCTCCAGTCGTTCATTCACTACCGCCCGA
TCACGTTGATATTGGCGTTGTATACCATATCTCCATCTTCGGGCATCTGGATCCCGGGGTTTGGTAGTTCCCAACGGTATGGTTGCTTCCAAGGCCGATC
TTGGGTCCCAGCCGTGAATCAGGTAGAACGGTGTATCTCCTCGAATTCGATCATGAGCGGTGTTGATCGCATGAATCAATAGCTCTGCGTATTCGTCTCA
GTCCTTTTGATTTTCATCCATGACATGCATCTTGATCGATCGAGTCAGCGTCTGCACCATTCGATCGGCCGTACCATTAGCTTGCGGTCTATACGCCAGA
GTAGCCTGTAGTTTTTGTCCTGCGATCCGATTGAATGCTCGGAAGAAATCAGATATAAATCCCGGCTCGCGATCATGGCGGGTTGCGTCACTCGTACCTT
ATCGTCTGAACACGCACTCCTCGTAATTCTCTGCGATCGTCTGGGCAGATCTGGACGAGCTTGCCTTTGCGATCACATATCCCGAGAACAAATTGACCCA
CAGCAACAGCTCGGTGTTTCCTTTAAAGGATCTTGGCAACGAAGGGATGTGATCCATAGCTATAATCTGAAAAGGGTACGTCGATTGCATATTACCAGGT
GATCCACTTCGATCTCCCAGCCTTCCTTTTCCCGTTTCACAATCTACACGCTCTCCCACATACCGCTGCACACTTCGGTACAACCCACGCCAATGGAAAT
TCGCCCTGATCCGTTGATAGGTAAGGCCGATTCCTTGGTGACCACCCTCCAAACTTGTGTGGTAGTGGTGCAAGAAGTCTCGGTGTAACTGTTCTGGAAC
CACCAAACGAGCTAGTTCAGTACGATCTTCAGCTTCGGTGGCCGATCTCGGACAGAAGAATAGCATCCCACTTTGGTCTACTTCATAGTCCGGTGCGATC
AGGGTGCACACCTTAGCTTCAGCTGCCGATAATTTAGAACGTCTCCAACCAGATATATCTTCAAACTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTT
AATACGACCAATCCGTATCTGCTGCACAACCTCTTCCTGTAAAATCCTGGGCTGAAAACGTCTTCTCTGGGCTTTTCGAGTGATAGCCGCTACTTTGACC
GCACGATCAACTCGTTCTGGTAGTAGTAATTCGTTTAACCGATTGAGGGTAATCAGGTCCTGACACTATTGATCGGAAACCACAACTGTCCCTTTCTCTT
GCCGTAGAGCTTCACTCGCCAACCGATCTGCACTCTGATTCCAGTCCCGCTTCATGTTTAAGAACTCGTGGGATGGCCACAATCGTAACCTCTCCATAGC
CCTATGCCTCAGCAACTGCAGTCCCGGCGCTTTACAGTCGATTTCTCCTCGCATTTGACGGATCACCAAATTCGAATCTACGCAGATAATCACCCGTCCC
CTTGCCTGATCGGCAAGCAAATCAAAACTAAGGAGCAGCCCTCAGTATTCTGATTCATTCACGGTTAGATCAGGTGTATACTCGGAAGCAACAGCCACAA
TCGTCCATTTCGGCAGTTTCCATATAATCGCGCTGTATGCTCCGCTTTTTCTTTTCACCCTGGCTGATCCATCGAAACTGGCTACCAGCAGGTTTTAATT
CACACCTACTGTGGGTGGTGGCATGCTTATCGTCTGTCTTGGCTGCTTCCTCGGGGAGATCGCAATCAATACTTCATCTACTTCTTCATGGGGTGTTATA
CTTGCCGCAAGCATACCGAGTATTTCATCTTCTCCCTTCTCAGATTGCCTAACTTCCAACGTTCAGTTCGATAGTAAAGCAGCCCATCTTTCCAATCTTC
CGTTGAGGCCGGAAGATTGTAGTAACCATGCTAGTGTCTAATATCGCGTAAGCACCGTAATCTCACGGGATACTAGCATAGTATAACAGATATCTAGCAT
CCGGAGGAGAGCCAACACTTCTTCTCCACCATCCCGTAGTTGACCTCGTTGGGCTTTAGCGTACGACTAGAGAAAGTGACAGGCCAATACACACCATCAT
AATCCTGAAGCAAAGCAGCTGATACATCCCACTTACTAGCATACACCACGATCACAGGCGATCGATCGGGATCGAAATGCTTTAAGATTGGAGTTGTGGC
TATCTTAGCCTTTAGCAACGTGAATGCAATCATTGACTTCTCCCATAGATTCCTGCCCTCGGGATCGCGATCGTCCCCCGCAATTGGGTACCGATCGACA
TCGATCTCCGGTTTTGGGTACAGATCGCGATCTCCCCCTGCACTCCCTTCGCGAATAGCATCAAGTCTTACAGCAGAGGTAGGTTTTGGAGCTTCACTCA
CGCGGTTGATCTCATGGAAATCTGCTTCACGCAGTTCGTACAACACTGATGCGTAAACTGCGAAGTCTTCAATGAATCTACTGTAATAGTTGAGACTTCC
CAAAAATAACTGCATCGCTCGCAGCGTCAGAGGGAACAGGATGTTCACGAACGATCCCAGATCTTTCGGATTAGCTTCCAAACCTGCGAGCGAGATTTGA
TGTCCCAGATAATTCAACCTTGCGACGTCCCCAAAAACGTTTGGCCAAACTGATCGACAAATTCCACTTATCGCACACCTCCAATAATCTCTCCACTTTC
TCGCACAAGGCCTTCCACGACGTAGCTGGTACTAATATGTCATCAATATAAGATCTTCGACCCACACTGATGTTTTTGGATCAGTATCTGGTTCACCATC
AGTGAAGACATCGATCAACTTCGGCGATCCCGCCGTGGTCGATTCGGATTTTACGCCAATTTCAAATACCCATATAGAGCGTTATCGGTCAAACATTGGT
AAATCTGTGGAGCATTTTTCAACCCGAAAGGAATCCGTAACCACTCAAACAACCCTGAGGGTATGATAAAGGCGGAAATCGCCCTTGCTCTTTCCGTCAT
CTCCACCACCCAAAAACCACTCGCCATGTCCTTAGAGCAGTACCACATAGTTTTATCCATGTCTTGCAACAGTTCGCTGATCAGTGGCATCGGATACACC
ATCAACCTAGTGTGATGGTTTAACCGCCTGTAATCAATACACAGCCTTATATCTTCTCCGTTTTTCTTGATGATCACCACTATGGGGGACGCCCATGGTG
ATGTAGATGGTCGAATGATCTTGGCCGCCAGTAATCCCTTGATCAGATCGGCGAGTTTTTCTCGGAACTTTAGTGCTACCGGTCGGAACCGTTGTGCGAT
AGGGTTAGCTCCTCCCACGTCGACGTCACAAACTGCCCCACACGCCGCAGGAGGTAGAGTTTTACCCTCTCCAATAAGTAGATGCCGGCTCTTCCAAATC
ATTTGTCGCAACTTCTCTTGATCCTCGGTTCTTGGGGTGCCGGGATCGCCTACTTGAATATCATCAATCGTTATTTCTTGTGTGGGCGTAACCACTTCGG
GAAGAACCGCCATGTGCTGATCCACATCTTCCGCGAACAACTTGCCGCCATCATGGTAATACATC