Description :
From Genome Similarity Track
Location :
Scaffold_635:16827- 17904
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_635-snap-gene-0.11Gene of unknown function

Sequence
1077 bases(100 bases per row)
CGAGGGGGTCTCTTCGTCACGGCCGGTGGAGCTGCGTGGCCGAACGCCAAACTGCAATTGGCGCTGCGTCATCATATTCGCGGACTCAGTTGTTCTCGCT
CGCCGCAGCTCGTCGCTGCTGCTGGCGTTGCTTGGAAAGTTCAACATGGGACACTGCGGTGGTGGCGGCTGCGGACCGTTTTGGAATAATTCGGTCTGAT
GACTCTTGAGTGGACACTGAGTAGAGCTGACTGCCTGTTCCTGTTGGCGCGTTGGGTGGCGACGTGGTGTCTGTGATCCGGTGTCTCGTACGGACGTGTC
TCGTGTCGCGCGTGGTGAGTGTTTTCCTTTTGCCGCGTGCGACTCGCAGGCAAGGCAGTTTATTATCGGAACTGCAACACCGGCAGCACTGGACCGTTAA
ATGAGCGAGCGGGGGCTTGCGGACTCGGCGGTTGATCGTTTGACTTGCTTGACTGGCTGGTGTCGTTTTTCGTTTTTCGTTCTCGATCTTTTTGTCTTGA
GTGTCGAGCTCCTTCTCGTCTACTTTTGAAGAATGAGAGAGCTGGAAATGGGAGTGACTCGAGACCCCAGGGACGACGGCGATGACCGAAGGCTTCGCAC
TCAGACGAGGAGCAAGAGGCTGGAAGCTTTGGAGAGAGAGGAGGAGGGGAAAGCCACAGAGGACGCCTGATTGCTTGCTTGATTGCCGCAAGTACCGTAC
AGTACAACCAGCAAGAAACACGTGTTTGTTGCAGGCAGGCAGCTCGAGCTCGCTCTGATTGATCCTGTCGTTGCTCCTTGGGTACCTAGATGAGACGAAC
GTTCAGGTGTGATACCCTAGGTAGTCTTTTCGTCTCGGCCTTCCTTGTTAAAAGAGTTTTGTTGCGCATACCAGCTCCGACTGAGGAACTGAGGCTCGGT
CTGGTGATTTGGAAGTGGAAAACGCAGGAAACGAATCGAATCGAATTTATATTTGGTGGCTTTGTGGTGATTGTGCACAATCGGCGCTCTTGGTTTGACT
TGGCTTTTGCTCTCTTTTTTTCGAACGCTGCGTGCGTCCACCAGGAATTTTGAACGGCAAACAACAATAAAAAAACA