Description :
From Genome Similarity Track
Location :
Scaffold_78:16824- 19464
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_78-snap-gene-0.13Lim domain

Sequence
2640 bases(100 bases per row)
ATCCGAAAGGACTCTGATGGCTGgTGGTTTGtGCTCcTTGATGGCGAgAAGGGCCTCGTGCCCGGTTCGTATGTGCAAGTGGACAACCcGGTACcAGTCG
GACCGGACCcAGCGATCCTTGCAGCGCGCGAGGCGTCGAATCAGCGATTCATGCAATGGCGAAAGACGGCCGGGAATGAAAAGCAAGCTGCGGGTGGTCC
GTCAGTCGAGTACGATTcGCCCCTGGGACTCGATACGGCGAATGGCGCGGACGATGGGGCGAAGATCGGTCCAACGCATGTCGATGCACGTGCGAGTGAT
GGTGTGGAAGATAAGCCCAAGGTCGTCCGCAAGCTCAAAAAGTGCCGCGCCTGTAACGAGACGATTCTTGGTCGCACCAAGAGTGCGAAGGGAGACATTT
TCCACGAGATTGTGAGTTTTCATTCCTCCATGATTTGGGCGAAAGGAGCATGGGGTGCTGAGATGAGATATGTTGCAGTGTCTGATCTGCCGTGGGTGCC
GCGAAACGATCGAAGAAGACGACGAATTTACGATCATCAAGAAAAAGGTGGGACAGCAACGCCGAGAACTTGAGATTTAACGTTCACTGACGTGAGTGTC
GCAGGCGTACCACGCCACTTGCGCCCAAGATCTTGCTGTGTGCAACATCTGTGACAAGGTACCTGATCTCGGTCTCCTTCATTATTACTCTCGCCATAAC
TTCAGTATGTTGCTAGGAAATCCTGGGACGTGTTTACAAGGCCGCTGGTGTTTCTTTCCACAAGTTGTGTATGATATGTCCGCAGTGCGAGAAGAACTTT
GAAGAAAGTGAGTATCATCCATGGGTCTTTGATGACCTACCTCAGCAGCTGATGTATTCAATTTGTAGATGGAGCTGCGATTGAGAACGACGTGCTTGAA
TGCAACAACTGTATCGCCGAAAGGAGTAAGACGGTTCATCAGTCGGATAATTGATTATTTAGTATGCTGACCACTGCGTTCGTTGTCAGAGAGAAAAGAA
GAGGAGGCGAAGGCTGCTGCGAAAGCAGCCGAAGAGGCCAGAATTGCCGCAGAAAAAGCAGCCGAGGAAGCTCGTCTTGCTGAAATCCGAGCAGCGGAAG
CTCGAGAAGCGGAGCGGCGTGAGGCAGAAGAGCGTGCCGCTGCTGAGCGAGCAGCTGAAGCCCGTGCGGCGGAGGaGCGAGCTGCGGCGGCAAAAGAAGC
TGAAGAAAAGGCAGCAGAGGCCGCGAAGCTTGCAGAAGAAACTGCGCTCTTGTCGCTCCGCGAATCGGAGAAAACGGCGGCCAGCCAGCGTAATCGTCAA
AACTCCAGCTTCATGGaCACTACGAACCTCGCTGAATTCGATCTCGGGTCAGCTACGCAGCGTCAAACAAATGAGCGTGTGTCAGATACGACGGACTTGG
ACTTCGAAAACGACTACGGCGGAAGCTTCCTATCTCTCAATGGCGAGCGTGATTCGCTTCGTCTGTCACAGGTGATTGACTTTGGCGCAGTCAACGCATT
TGACTCCAGTCGAGTCACTGCTTCAAGTGATCGCATGTCGACGTTGTCAGACTTGAGCAACATTTCCGAAACAGATGATTTCGACACTACCAACATTGGA
ACGAACCGAGGTAACCGAGCCTTGACCCTGAACGAAACTATCTCGGAAGACGAGGAGGAAGAAGGAGAACATGAGATGTGTGGCGAGTGTGGGGCGATCC
TTGATGGAGAAGCAATCGGTGCTTTGAACAAGTTCTTCCACACTGAATGCTTCAAGTGCAGTCACTGCCAAAAACTCATCTCGGAGGAAGATGGCTACGC
GGAGAAGGACGGAAAGGTATGCCCATTGAGATAAGACAGTCTATCGATAAGTTTACCAAGTGTCTCTCGTGTAGGCATTCCACCAGGAGTGCTACCAGGC
CCGATTCAGCAAGCGTTGCTGCAGATGCGAGAAGGTGCTGTGTGAGTGATTGGGCTGGCGTAACTTCAGCTAATGTCACATCCCTTTGTAGGTTCTCAAG
GGCAAGGTCGTGAAGGCTCTAGACAGCCTTTATCATCCAGACTGCTTTGTTTGCTATCAGTGCAATTCGTCTCTCTCTGGTAAAACCTTTTGGACCGATA
CCACTCAAAGAGGACCGCCCTAATATCTGTTGCGCGTCCTACCAGAGAGCTTCTTCGAGCACGAAGGgCAAGCGGTTTGtGCTCAGTGCAAGCACATCGC
GATCACCGCAAATGCGGCCCCCGTTCCGTAAGTTGCTTGGTTGGACTATCTTCGAAAGCTAACTAACATTGTCATCAACAGGGAGAACCTGCCCGCTATC
AGTATTGGAACAGTCGGATACCACTTCGCCGCACAGGATGAAACACAGCTCACAATCGTCCCCGGCCAGCAGGTTTCTATTCTTCAGAAAGATGATGATG
GCTGGTGGTTTGTGGATCTGGATGGACAGCGTGGATACGTACCTGGGTCATATTTGATTGAACACCCTGTTGCCACTCGCAAGGACTCTGCTAAGCGATC
CCAGAAGCCAGAACCGAAGCCAGAACCAACTCCTCCAGCTGCTCCTGCCAAGGTCCCTGGACTTTGCAGTGAATGTGGAACGCCAAACCCAGATATCGCT
CGATTCTGCCGACGATGTGGTAACGGCTTGATGGACTAGA