Description :
From Genome Similarity Track
Location :
Scaffold_62:168224- 175859
Transcript NameFunction/comments
Phyin_T30-4PITG_18420Protein kinase%2C putative
Phyin_T30-4PITG_18421Large subunit GTPase 1
Phyin_T30-4PITG_18422Putative uncharacterized protein

Sequence
7635 bases(100 bases per row)
CGTAAGACGATGTTGGAAGATTGGAGAACTCAGATCCATGAAAAGCGTACACTTGTAATGAGGTGGATCAAGGTAACCTAGATCCGGACAAGTGTACCCA
TGATGTGACAACCATAATGATTACGCCATGGATCCGGTGGATCTGATGATAATACACCTGGGATGATGGGTCAAGGAGAAAAAAGGACATGCAGCCGAGC
CTGCTAGGGGATTTAGCGGGTAAAAGACATAGAAGGTAGAAATTTAGGCAGGTATAGGCTTAAGTATCAATACAGCCCTCAATTTGCACAGTATCACGCA
AGTTCCTTCCTGTCCTCAAGAATCGGAACTACATTGGCCGTACGAGCTCGGTGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAAT
ACATTGACCAGATCCTACAACCTAGTGAGCTTTCCTTTACACGTGCAAATCCGAAAGGTTAACCGGATTTACTACTTGGCCGACAACACCCTAGAGGTTC
TCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGAAAAGGAAACACAAAGACAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCC
TGATCTAGGCCCTGGATCTACCAAGCTCAAATACTCGCTTAGGATCCAGAAACATCTACGGACGCAGAGTGAAGATCTTACCACTACTGCTCCACCCATC
CCCACGTCTCGCCATAACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGGGGA
AAGTTCAACAGATCACGGATCATCGGGGGATCCCCTCCGTTAGTCGGTGTCTGGGCGCTGTTGGTAACCTGGATCCAGCAATTCCGCAGATTTTGCTGAT
CCCGCTACACCACCGGATGGTATCCGAAGACTACGCGGAATGGTGTGCGCAAATGGAGGAACTGGAACAAGTGGAGCGACTTAGCTAGGAGTTTGGCGTC
TAGACGGTGGAGTGTCTACAGAGAGGAAGAGGCCTGTGGGGACTAAGTTGCGTCGCTCGAGCAAGGATGAGGTCCTAAGCCGGACTCACGAGGGTCACCG
TTCCTACTCGTGACCCCCCCGACCCCCCCCGACTAAAACCCGACACCCTCGTCGAGCCTCCGTAGCTCGGCTTTCACGCATCTTCGTCAGCAACGCACCC
TTCTCAGTCAACATCGCACTTACGGGAGCGGCCACTTCAAGGTGATGGGCTCTGGGAGCAGTCGCGAGTTGGAGCGACTGGACATGAGTGCTACACTGAG
ATTGTTTTAGATGGGAATTGTCTTCTCGAAGGAACCCAACGTGCCCTCCTCAGTTGTGATATTGAGACCAAGGGCGTGACTGTGAGTGGGACGACAAGGA
CGGGTGGCGAGAGGGCCATTACGGAGTGCAGTACGATGAGAAGATGCCCAAGGTCGGTAGGGGTGTCATGATTATGTCGAGGGGGTCGTGCCACGATCCG
GTTGGAACAGGGTGTTCCCGGAAGGTACTAGAGAGGCGGATGCTGGTAAGACTCAAAGGTCGATAAGGATGGAAAGGTTAGTGAGAAGAGGCCAGTCGTG
AATCTGCCCGGTACTTAACAAGTTGAGTCTTTGTATTAAGATTTTGGCCTGTTAAACTAATATCACTACCGACTGTAAAAGCTTCGCGCCGATCCGTCTG
AAAACATTTCGCTGCAGTCCCGCCCCAAACCAGGACTACTCGCGACAAACCATTGCATTCACAATTTCAGCTCTTTTCGACAGCCAATTATATCACGTGA
AATAGGATATTCTTGAGATTATTTTGAGGTTTGACAGCTCATGAACAAAAAATCCTGGAAGATATTGTGGCTTGAAAACCGTACTGTCGATTCTTAAGTG
GTGGTTTTGCTCAATCGTATTTTTTTAATCCAAATGTACCGCAAAATATGCCAGTTTATACCGGTATCCAGTCTCCATCTCACTTTCAGTCCAAATTTAA
TCTTTTAGAACATTACACCTACATAAATCGGCTTTGGCAGGCACTGTAAATGGGGCATTTCCTCCGGTAAGAAAATTTCTTACAAATCCAAAGGTATTAT
GTAAGTTCGGCTTTAAACCGGTATGAGTGCAAATGCCGTTTAGAGCGCTTTTAGCAGATTATTAGTTTTCAAGACTTAATTGAGAGCGGCAGGTCGCTAT
TCGCACTTAGGACGCGACATATGGAACAACCAAACAACGCTCTTTGAGCCGGCTGCAAGATCAAAAGCGGTCGGTCGGTCGAAAAGAGCTACAATTCGCT
AAATTTTCTCGGTCGGTCGCATGAAGAAGAAGATTTGATGTAATAGCTGTGTGCAAGTTGTCAGATTGTGAGGCACGTTGTCGGGACGCGGGGTGGAAGT
CGCAGTCCGCATTTGTTCGCGCGTAAAGGAAAGGCCGGTACGTACAGCGGCTTCCCCACGTGTCCTCCTCCTTGTGCTGTTGTCGGGCTCATTCGCGTAT
TCGTCCATCGGCACAGGTTTCCTCGTCCGATACATTTTCTCCCTCCCTCCCCTCTCCTCTTCCACCAGACAAGCATGGGCAATAAGGGATCCAAGGGCGC
TAAGAGCCTCCGCCCACCTATCAAGAGCGACTCGCGCGGCTTCAAGTTTGGAAACTACGCCAACGGCGGTCGTGACGCTGGCAAGAGTGCGCCCGCCGCG
CCCTCGTATCCGTCCAACGGCCCCCCGCCAGCTCCTGGCCAGGGGCAGGCACAGCAACAACAGCAGCAGCAGTCTGAGGAGGAGTGTACGTGGCACTTTA
TCATGCACTTAGTGAGTATGAAGGTTTCAGTTTGCTGACGGTTTCTATCTCTCGTGTGTGTCGCCTCATCGCTGCAGCCGACCTAGAAGACGACGACTCA
GGCCCGATCGAGCAGGTGGCAATTGAAGATATGGACGGCCCCGCGCGCCCGCAGACTAAGGTGAATGTGGAGGATTTCGACCTGCTTAAGGTGCTCGGAA
AGGGCTCCTTCGGTAAAGTTATGATGGTGCGGAAGAAGGACACCAAGATGATTTACGCCATGAAGACGCTTCGCAAGGCTGCGCTCGTCAAACGCAACCA
GCTGCTACACACCAAGACGGAGCGCAGCATCCTGCAGAGCATCAAACATCCGTACCTGACCAGTCTCACATACGCCTTCCAGACCCCCGACAAGCTCTAC
CTGGTCATGGATTACTGCGGTGGTGGTGAGCTCTTCTTTTGGCTCAAGAAGGACCGTCGATTCTCGCAACAGAAGGCACGTCTGTTTGCCGCCGAGATTA
TCCTCGCTCTGCAGGAGCTTCACAAGCATGACATCATTTATCGTGACTTGAAGCCCGAGAACATTCTGCTGGATCTTGAGGGACACATTCGCCTCACGGA
CTTCGGTCTCTCTAAGGAAGCTGTCACGGGCGCCGGCGCTACGGGTGGCACCAAGACTTTCTGCGGAACCCCCGAGTATCTTGCGCCTGAGATTTTGGAG
AACAAAGGACACGGCAAGGCTGTGGACTGGTGGAGTCTCGGTACGCTTATCTACGAGATGCTTACCGGTCTTCCTCCCTTCTACGACCAGAACATGCAGC
GTATGTACGACAAGATTCTGAACGCGCCTTTGCGGTTTCCGTCATTCATGTCGGCTGAGGCCAAGGACCTGCTAACTGGTCTGTTGACGCGTAAGGTGGC
GGACCGTCTTGGTAGCGGCCCCACGGATGCTGAGGAGATCAAGTCGCACCCGTTCTTTAAAGGAATTGACTGGGAGGCTGTGCTTCGTAAGGAAGTGCAG
CCAGAGTTCAAACCGCCTAACCGATTGGGCTCCATGGACACGAGCAACTTCGATGTCGAGTTCACTGCTGAGAAGCCTGTGGATTCGGTCGTCACTACGA
CAATGAGCGAGACGCAGCGCAACAAGGCACAATTCCCTGGCTTCACGTACAACGCGGATACCATTGATGAAGACCACAAGGGCAATTAGATCCTGCCGTT
CCTGTCGCTTGCGAACCCCTCTGTCCCTTCTGGCAGTTAGACGAAGAGAGATGGAAAACTGAAGAAATTACAACAAAGGAGACTTGGTGGAAGTAGCAGG
GGCGGACGTTGCAGCTCGACCCCCTTCCTTCTTTTCTGAAAGCAATGGTCGAGCGGCGAAGCAATGTTTTCTTTTTCATTGTGTGGCCTCGCTTCTCGAC
CATTTCCATTCGTTGATCCTGCGTGCATGCAGGACGACGAAGTAAGTAGGAAACCACAAAAAAAACATTGGACGAATGAATGGACCGATCAACTTTGGGA
TTCTTTTTTGCATGTTTAGAGATGAAGCTCACAATACTACACTACTAAAGCCCTTCATGCAGCTGCATGTAATAGAACCTGTGTTAAAAAATCTATCCAT
GCGCTGGTAGTCGAATTATGGCCTGCGGTTCTTCTTCTTGCCACCTGAGTTGATGCGGACACCAGCAGCACCACCAGGGAAATCCGAGTCTTCATATGGA
TTCTTATCGCGTCCCTTACGTCCCTTTCGGCCATGTTTCTTCAACCGTTTGCTCACAGCGCGCTTGTCTTCCACAGTTGTGTCAAAGTCCAGATTCTTAT
CCACATTCGGCTCCGGCGGCGAAGTGACCTCCTCGCTGATTTCATTTTCAGTGGTGTGAAGGACGATGGAATCGTCGAGATCGGGGAATTGAGCCTTAGC
AAGATCATGGATGTCGAAGATGGTGGAGTCCGAGACATCCGGCGGAGGGTGGCAGTACAACAGTCGCCCATTCACGTAATGCCGTAAGATGTCGCGTGCT
GCGCGTGAGGTGTCGGGCCCTCCCTTGCCAGTCGTCGTGTAGCCGCGATTACGTGCGTACGACTGTAGCAGAAAGATAAGTATGGGTTGAGCTATAGCAG
CACCGTGAAGCGCTTTATGTTTAGTGTACGCACCTCAAGGAGTGCGTAAATGCCGACAGAATCCGTTTCCTTCGCCGTCTTGGAGATGGGGATCTTGATT
CCGTAAGTTCGCTCAAACACCCGCCTCGGGATGCGGTGGCACAGGAGCTGGCACGGGGCTATTTATTCACACAAGACACTTATCAGTAGGATGGACATCC
GCTACAGTACAACAAGCAAAGTAATATATGAACGTACAAACGTGATCACGCAACTGCGAGAGAGGGAGCACACCGCAGCAGTACATCTCAGCCTTCGAAT
TAACAAAGCTCGGGAACACGAGACCAGGGCAATCGCACAGCATTATTTTGTCGGACAGGATCATTGTCTGCAAGTACAACAGAAGCGTTAATCCAGCAAA
AATGGAGCTGTAAGAAAGGGTAAAGAAGATCATAAACACTTCTGCAAACCTGGAAGTGCTTGGTCTTGCCAGGAGTAGCACCGACAGCAACACGCTGGGT
CTTGTGTGAGTAAGTTGAAGCACCAAGCAGAGCATTGATCACGGAGCTTTTGCCAACGTTAGGGAAGCCCACCATACCGAACTTGATCAGCCCCTTATCC
TTCACTCGCACTCCCACCTCATCCAGCACCTCCGTGGCGATCTTAGTCACATAATCCAGCAGTTCGACACGAGAGAGCACCGAGTACGGGCTGGAATCCT
CTGTAGCATCCACTGCTTCTGCTTCAACAACTTGTGGTGCGTCAGCCGGCTTCACTTCATTGTACTGGTCGTGACTCTCGGCGTTTCGCTGCTCCTGACG
CAACTTTTTCGCCTCCTCGTCGATTTCGTCCTGAGCCTCTTTGGCCGAGAAGAACACGAAGTTGATATTTTCCTTCTTAAAATGATCTCCCCACGCCGTT
CTACGCACCAAGATTCGTTAGACCTGCGCCACCTGCATGCCATTAACCCATACAATTCACCTTTGGCGTTCATCCAGGAAATCAGACTTGTTGACGACCA
AAAGAGTACGACGGGGCGTCTCACCTTCCTTCGCATACGCGTCCAGGTCTGTGGAGCTATAAACGAAAGGGCGATTAGTATAAACCATTCTGTCCGTACA
AATCTCAGGCTCCACATGGCCCATACCGATAGAACAGCGGGTTGCGAGCGTCGACAATCTGCACCATGATGTCACTTCGTTCACGGACATGCCACAGCTG
ACGCCACACCTCCAGGTTCTTCTCGAACGGGGTTACCTCGAGGTGGTCGGACGAGGCCTCCAGTCTGCACCAAACAGCAAAGCTTTAGTCCAGAGTCTAC
AATCTCATCACAGAAACTTGCCACTCACATGGCAATGTCACGACGCCACTCGAGGAAGCTCTCCTTCTCCATTCTGTTAAGTTCCTCGGCTGTCATCGAT
TTGTCCCATTGGGGTCGACGCGGCACTTTCATCTCTGCGAACGTCATCTCCGGCATCACATTCTTGTCCTTCCTGTACTCAGCAACAAACACTGAATAAT
GTTCCTTTATGCTGGGCAACACACCGCCAATCATTTAACGTACTCGACCACCTGCGGACCGGCGTCCGCCTCTTCCATCAGCATGATACTCTCCTTCACA
GCGGTAAACTCACGGTTGGCCAGCACAGCGCTAGCCAGAAAGTCGTCCTGCAATATTAATGCATCTGCTAGTCAGCATATGGGGCTGTAGCCAACCCAAA
ATTGAGTATCGTCGTACCAGAGAGGACCCTTCCAGGTACGAGGCAAGAGCCACCGACGCGTCACCACCATCGCGCTCGGACACGTGCTTACCGGCACTGG
AGGCCACATCCTTCGTGTTGATGGGTGATGTCTTCTTTTGCGTGCGCAGCAGGGCGTTGCCCAGCCCGCCCTTCTTAATCTTGGCACCGGTACGACCCAT
TCGGTCTTCCGTATCACTGGAGGGCAGCTGAAAAGTGTGTGACCCACACAGATGAATTGTTTCTATTTTTCTGACGTTTCACTTCAACAAGGCTTCATCG
ATGGCCGACTGCGTGACGCTCACGCTGCGAGGCGAGCGAATCCCGCTGTGCAATGCCGTGTCTTCTGTGTACAATGAGGATCGACATGAGCTGCTGGTGG
TCACACCTACCGCGCTCTACCTGTACAGCAACATGCTGACTGCAGGAGGAGATCTGCTGGCGACTCTTGTGGCGGAGGAGAACGCACACTACCAGTTCGC
TCTACATCTTCCCTGGGTGGGTGCCACTGTTTACAATTTGCAAGTGACCTACTGACTATGGGCTGTTTTGTTAAAGCTGGATGCCTACTCCGTCGTTGTG
GCCACTTCGACGGGTCAAGTTGAGCACAGAATCGTCTGGTAGGCTGCGATTGTGCTGCTGCTGTGTTTAAGATCTAATATGAGATTACGATACACACACT
GTAGCTCAGACCTCAGAGCGTCGCTGACGTCACACACGCTGGTGGAAAAGGACGGGGGACAATTTTACACGGCGCTGGCGAATCCACGCCGACGGGAGCT
CGTAACTACAGACACAGACGGAGGGATCAAAGTGTGGGCACTACGCGTAATCGCTACGGCACAAAACACTGGCGGATTTAAGGGCGTGTTGCGAGTGCAT
ACAGCTGCAAAATCGGTGGGCGTGCTGGTGTCGCGTCAATGTTCTCGCCATTTGCGTCGCTTACAGCTGATGCGATGGTGATATGCGAGCAGGTCAAGAA
GACCCACTATCGCCACCTTCGAATGAGCTATGACG