Description :
From Genome Similarity Track
Location :
Scaffold_215:16822- 23616
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_215-snap-gene-0.11Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_215-fgenesh-gene-0.7Axonemal dynein heavy chain

Sequence
6794 bases(100 bases per row)
GCAAGGCAGCGAGCTCCAGGAGCTCCAGGAGCTCTTGGCGCGGCACAACAAGAAATTCAAAGCCACGCACACGTACCAGCCCCCGCAGCACTCCGTGCGG
GATGTGCGAATGGTAAGAAGCGTGTTGTAGTGGTGAGCATGTGGTTGCGTGACTCATTTGTGTTTGTCTGACTTGATGCGCCGCAGTGGGAGAAGCAAAA
CAGTTTGTCGTACTACAGCTTGACGTCGGAGGACCGCATTAGAGCCAACTCCGAGATCGCAGAGCTGGTCCAGGCTCGAGAGAACGCAAGACGGCAAAGC
AGCGGCTAGAAGCGGAGACGTGCTGCAATGGAAACTGGTTCGTAGCGCTCTCTCTCTATATCTATTGAAACTGGAATATCAAACTATCAAACGGGCAGAA
AACTACGCTTTCCCAGATTTTTTGTATGTCGTTGCAAGGACATTACGCTGCGATTGCTTCTTTCTTATGTGTCCAGCATGCAGAGCATGGCGCAGCCGCG
TCGGATCCAATGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGGATGTCCAGCGCGACGACAAAGTTGGTCGAGTGGCCTGTCGTTGAG
AGCGTGCCCGCGCGGATCGACGTCTTGTACAGCGGACACTCGTACACGTCCACAGGCTTGTACTCTTCCTTGCGCATGGGCTTGAGCCAGATGACGGGCA
TGCGGTCGAAGAGCTCGTTCGGGATCGACTCGGCCATCATNNNNNNNNNNGCGGTCGTACCGCGCGCCCTCCATGAAGAGCCCGTAGATGTAGACGCCAA
AGGGCGGCGGCGCGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTCTCGCACGACACCACGAGCGCGTCGATCGCGATCT
GCCGCTCGCGCGAGAACGACTGCTTGACGGCCGTCATGAAACCCTGCGGGAAGAAGAAGCCCGAGAGCCAAAATGTCATGGGCGGGCCGTTCACGAGCCA
GTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCCTTCGGGATCTGCTGGATGAGGAACCC
GTTGTACATTTTCTCGAGCGCGCCCGACATGACCACGAGCCCTTTGATCGCACGCTTGAGCATCTCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTGAGAGGAAAACACCCAGCGAGTTGCGGGATCCACCAAGCGCTTCTTTGAACGTCGACGCGTGCGC
TCTGCTCTCGGCAAACAGATCGGGCATCCGCTCCTGAATCGATACGACCATCTCCATGACGATGCTGTCGTTGCTCTGGGCGGCCGACGATCCTCCGCTG
TCGCCTCCTCCACCTCCTCCTCCGAGCATTCTCAGGATTGTACCCAGCAACTGCCCGGTCTCTTTCTGCTGAAACGTGATGTCGGCATTCGCGTGAAGAC
CGAAGATGTCGGGCGCGTCTGCAGTCGGCAATGAGCTCACGTACTCGCGCACAGACTGGAGACTACCCTCGGGCGGCGCAAAGTACGTGTTCGACGTCGT
GAACCGGTACGCATCGTCCATCACATCCTTGCAAAACAGTTTGCGCATGATGCTCGAGTTCGTGCGCTTGTCCCAGCGATCGGTGATGCGGCCGCCATAG
GACACGTCGGCGANNNNNNNNNNNNNNNNNNNNNNNNCATGACGTTGAGCGTCACGTACGGCACAGTGTCCTGCTCTTCCAGGTACAGTCGCACTTGCTG
CATGCCCGTCTTCAGGTCGCTGTTCATCCATTCATACGGGATGTTCCAGCCTACCGCCCCGAACTTGCGTCGCTCCAAGCAAACTGCATTGTAGAATGCG
AGCGCGAAGACGAGCTTCTTGAACTCGCGCTGCTTCGTGCACCCTTCGTAATCGGACTCCTTCATATCGAGGAACGTGCGGCCGAGGTTCGCACGGATAC
CCTTGGGTGGCTCATTGGTGATCTTGATGCCGTTTTGCAGGATTGGCACAGGGAATCGTGCGCTCGGCATGCTCGTGAGCCACAGCCGGAACTCCGGATG
CATCTCTTCGCTCTGCGATTGCTCGAGGATCTGCTCCAGTCGTCCAAGCCACGAGACCGCGAGGTGACAGTTCTGCAGACACACCCAGTCGCCCGTCTCC
TTGGATTGCTTCATCAGGGCTTCGGCGATCGGGCCTTGGCCTTGGCCCAGCGAAATGATCTTGAGCCCCGAACCTTCTTTCCCCTCTTGCTTGGCGAGCT
CNNNNNNNNNNNGAGCAGGTAATCGTTGATGTCGGCACCAGGGGACAGCACAAAGATCAGCGGCGTCTCCGGTTTGGAATCCCGGTAGCAGCCATTCAAG
TCGAACGGAGGCGACTCTGTGAAGAACGTGCCGNNNNNNNNNNGCGACCGACAAACTCGCGTGTGCCGAACACGAGCATCTCTTCGCGAAACACGCGCAG
AATCAGCAGCTTTTGGAAGTTCATCAGCTTGGTGTCCCATGGGGCAGGCAACGGCTCGGCGTGCGGGAGATCCGAGAGTACCATCGCCTTTTTCCAGCCA
TTGGCGTCACGGATCACGGATTCCGGGATTTGGTCGAACGCTGGCGAAATCTCCTTGAGTCCGAGCAGCACTTTCCAGACGCGGTCCGAGAGCCACAACG
GACGCGTGAGNNNNNNNNNNTCGACGCTGCCAACGCGATCTGCGCTGCAGGGCTTCGTTTGTCGCCGACCAGATAGAAGTTCCATTCCTGCGCGTGNNNN
NNNNNNTCGCGCCGCGCTGCAATAAGATGCTGGACGCGACCATGAACGCGAACACGATCTTGTCTTTCTCAAAGAGACCGCGGCAGACGTTCACGAACAT
CGACATGGTGATGTCGCTCATCAAGATTTCGAGTCGTTCATCGAGCACGTCAGATTTTGTCGAGTTCTCCAGACGCATCACAAAGAGTTTTTGGTAAAAC
TGGAGCGAGTACTGGTACATCGGGTCCACGAGCGCAAGGCTCGCAATCGCAAAGTAGATGATCGAGCCGCGAATCGCAACGCAACGGTACCCTTCGCGCG
TCTGGTCGATCTCGAGTGACGTCGTCTCGGCCTCAGCCATGCGCGTCTTGATCGCCGACGACGTCACTTTACTGTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNGTCGATGAGCTCTTCGTCGTCCAGGATATTGCCCTGCGAGTTCTCAAGCATGTACAGGATCTTGTCCTCGATCTCTTTGAGCTGCTTCTTGTCGGCC
GCGATGTTGACTGTGAGCTCGTTCTTCTTCTGCTCGAGGTCCGGTCGCTCGCTGCGCACGACGTCCACCAAGAGCTGGTCTTCGAGCCCCGTGCGCGTGA
CCGTGAAATTGATGATCGTCACTTTNNNNNNNNNNGCAGATCTCGGGCATGTAATGCGGGTTCGCGAGCTTGGTCGTGATGTAGAACCGGAAATTCTCGC
TGTACGGCACGTCACTGTCTCCCAAGTGCAGCAGGAACTGTCCGCCGCGCTTGAACACCTGCTTGAGCAGCACGGGCTCGAGCGACGGATCGAGNNNNNN
NNNNTTCGACGTTCTCGAGCAACACAGGCGCGCCGTAGCGGATCGCGTTCTCGAGTGTGCGCAGAAAATCCTTTTGCGTGAGCTTGATGATCTGCAGCGC
GTTGCTCGCCTTGTACATGTTCTTGATCCACTTGTTGGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAGCGTCGTGAACAACCCATTCTC
GATCGAAAACGTGTCCGCGGGCAGTCCCATAATGTTCCATTCGCGCACGACAACCGGGTCTGCGAGCACGCGCTGAAACGAAAAGTGGCTGTCCACGGGG
AGCCCACTCTGTTTGCAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGTACGCA
ATGCAACCGGCCGACAAGATCATGTCGCCGACGAGATTCACCATGTCGATCGCGAGGCCCTCGGCGCATTCTTTCCAGCGACCCTGCTCCTCTCCAAGAG
AGTCAATGAGCCGTTCGGCACGCACAAGTTGCGCCTGCGTGGTCTGCGTCTGCTTTTCGAGGTCGATCTTCTTCTGTTGCGCGTCCTCGAGTGTGCGTTT
GAGATCGGCGACTTTCTGGAGCACGGCGTTGAGTCCAGACTGCTTAACCTGCAGCTGCTGCTGCTCACGCTCGAGCCGCTNNNNNNNNNNNNNNNNNNNN
NNNNTTCTCCTTTTTTGGGGCAATGTTCTTCGCGACCGTGTCGTACGTGTACATGGCACGCGCCCACATGCACAGCGACGTGGCGGCCGTCGAGATGCTA
CTCAGCNNNNNNNNNNGGCGTGAACTCTTCGTCGGCCATGAACTTGGCGAGCGCGCGAATCGTCTTCGGCGGGATGTTGTCCTTGTCGTACTCCTTGAGT
TTGTCGAGAAATTTCATGTCGTTCAGCAGCTTCTTGGCTTCGTTCCACTCCTGTTTCGCGCCAAAGAGCAGACACACGGCGTTCATCGTGACGCCGACGA
GCCGCGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCTTGAGCACCGTGATATCGTCCTTCTTGAGCTGCGACAACGCTTTGATCGATGCAT
AGTACGCCGGCATGGCTTCGTCCAGATCCTTCTGGCAATCGTCCTTGATCGCCTTCACTTCGTCCGCGATCTTGTTGGCGGCTTCGACGTCGCCCTGGAT
GAACCGCTGCTGCGTATCGGCTTCAGTCTGGTCTTTCGCGACCTGTATGAGCAGCACGGACGTGTCTTCCTGCGCTTTCACCAACACAGGCTGCAGATCC
GTCAACGATTTCTTCAGGTTGCCCACGATTTCCTCGGTTTCGAACAGTTTCTTCAGGCCACCGCGGTATCGCGCTTCTTTCGCTCGCACCAAGTGTCGAT
GGCTGCGCAGCATGTCGACGTACAGCTTGATGAGCTCAAGGTAACTCGTGGGCGTCGTGTAGTTGTGGCGCTTGAGCTGGTGGTAGAACGTGGCCGTGGC
CTCTTCGACGCTGCGGTGAATCGTGACCGCCATCTTGCAGAGCGTGTCGACGTGGCTCTCAATGCCCAATTCCTCGGCACTCGTCGCGAAAAAGCGCTTC
GCGACCGAGTGCAGCGCGTCTTCGGGCCACGCGTTGAACCAGTCGATCGTGCAACAGTTCACGAGTGACGGAAACATACGGCATCGGTTCCGGAAGCCCG
CACCGAGNNNNNNNNNNNNNNNNNNNNGACACTGCAAGCACGATGTGCAGGTTCTCCCGCACAAGCGTGACGTAGTATTGCAGGATGTCCTCACGCGTGA
CTTTGCCGACTTGGGCCGCAATCGGACGCACCATGTTGACGATCTTCTCGATCTCGTCGCTCGCGTACAGGTTTGGGACTTCACCCGTGTTGAGCACGTT
ATTGATGTCTTCGAGAAACGATTCATGCACGATCTGCGCGTCCGAGAACAAGAACACGACCGGTTTGTTCNNNNNNNNNNTAGGTCTTCGTGGAACTCGT
TCGCGCCGTAGCCGCGTGTGATCTCGATCGAGAAACACTTGTACTCGGCCATGAACGCCGCCAGCCGCGTCAGANNNNNNNNNNCACCAACGCCGACGAG
GAGCGCGTTGCCGCCTGGCATGTTGAGCACGCGCACGATGCGTGACAGGTGCTCGATCGCGAACAGAAACATGACGAGGTTCATGGGTTTGCGGCTGATG
CCGTTGTACTCGGTCAGGTACCCGTCGAGGCACTGGATGAGGGCCGTGATGCCATCAAAGCCCTCATCGCCAGGCTCGAGCCTGACGNNNNNNNNNNGCG
CGGTTGCCGAAGCACGCGACAGATCCGCGAGATGTGGTGCACGGCATCGTTGAAGAACACCAGATGCATCTGGCTCGGGAATGTGATGTTGTACTCTTCG
AGGTACTCCATGAGCAGCGTATGAAGCCGCGTGAGGTCATCCACGGGCCGANNNNNNNNNNAGGTAGTCCCCGAAAAAGAGGTTGCGCATGTCGGTTGCG
GTCACGGGGCCGTCGCGGCCGCGCTTCAAAGACACGAATACCTTGTCAAAGTTGGTCGCAAAGTGCTTGATTGTGAGCTTCTTCTGCGTGTCGTTGAACC
ACTCGCGGTCGTCGTCGTCGACGAGGCGGTCNNNNNNNNNNGTCAGGTAATCGCCATACAGCAGATTTTCGAATGACTCAGGAGCCCAAGAGACATTGAC
GTGTTCCTGCAGCAGTTCTGAGCACGCACCATTGAACCAGCACCGGTCGTCGGCATCGACGAGGCGATCGCGGAACACGCGCGCTTCCTCGTGGAGCCAC
ACCTTGAGCAGTCCTTCCTCGCTCGTGACGCTGTCCTTCTTGATCATGAGCATGCCCTGGAACACTTTGGACAAGTCACGCAGGTTGAACGTGTAGTNNN
NNNNNNNACGCGTCGCTCGGCACGACAAGCATGATGCCCTGCACGATGCGCGAGAAATCACGCAGGTTGAACGTGTAGTGCGACTTGGACGGCGTCGGAA
GCATCTCGAGCTCCACGCGCTGGTACAATTGCACCGACGCATTCACGATTGGTGTCGCCATCTGGATCAACAGCGGGAGCTCAAACGTGAGAAAACCCCC
GAGGATGGACGAGAAGATGCGCTTCATGGCCTCGCTCGATAGATTCGGGATCCAGACCATGTGGAAATGCCGCAAGAGTCTCGGCGAGACCTCG