Description :
From Genome Similarity Track
Location :
Scaffold_275:16822- 18800
Transcript NameFunction/comments
Physo_144831hypothetical protein

Sequence
1978 bases(100 bases per row)
CTACCGACTAAAGCCCAGGTAACCGTTGTGGCCAAGAATGAGAAAAAGCAAGCCTTAACGGAGTCGAAGCGGCGTGAACCAGGGCAAACACCAGCTCGGC
CAGCTCGTCCCGTTAAAAACGCGAGCCGAGCTACAACACAACCGTCTCCACCTATAAAGCCGACACGCCCAGCAACGAATCGAACACCGGCCCCTCCTTC
AGCACCGCACCCTTTATCGGCAACAGATAAAAAGCCCACCACTACACCGCGGTCGTCTCGTACCAGGTTAAAGCCCTCCACGGTTGATCACCAGGTATCA
CTAACGAATCCAGCCGAATACAATACGGAAAGTAAAACTGCAACAACGAGTGATCAAGCGCCACAGACACAGGTAAGCCCCTCTAAACGGAGGCCAAAGG
TCTCGTCGCCGCGGTCTCCTTCAAAACCCCCTTCTGCGTCATACCAATACCTGCCTAACGAGTATCCGCAACTCCCTCGGAAAGCACCCGTACCAAGACA
GAAGGCTAAGCCCTCCACCAGCGGAGAACACGGAGGCAAACGCCGGTTGCTTCAGCCTGTGAGGACGCCCGCCAACCTGCGCTTCGACCTCCCGAAGATG
GACAAGACAAAACGCGACTGGCTGTTTGCCAACATGTTCCGCCACGGCGACGACCTGACCAAATACGAGTCGTTTGTGCCGCCGACACTGCGGGCCAGAC
CCCCGACGTCCAGCAACCTGAAGGAGACCAAGAAGCGGCCGCTGTCAGCCAGGCAAGTGTATGGGGATCCGCAGCCATTCCGATTTGTGTCGCCTAGTCG
GAGACTCGTCCAGCAACCGAACCCTGCGCTTCAGGACCGAGAGCGTAACTGGGTGCCCACGACGCCCCACGACTCGAAGCTCCCGCCGTACGACTCCATC
CTGGACAAATACTGCACCACAGTCACGAGTCCTGTGGTCCAGCGCCAGATCTACCAGACTAGGCACCGAGACCTGTCCCCCCAGTTGGCCTTTGTGCTGG
AGAAGCGCGTTGAGAAGCACTGCCGCAAGGGCTTCTACGACTCGTTCGGCGGGGTCAGCTCGTCCTACAAGACTGAGATTGTGCCGACATCGCCTGTAGA
CGGATCGAGGCAGCGACAAACGTCCCCGCGGTCCCCAACCAAGTCGGAGATGCTACCAACAACAAGCCCCACCTCGGCCCCCGAGGATAAGTTGTAATGG
ACTGAAGTTGAAGTGAACAACCAATCGGATTGATTCGTTTTTGTGCTACCAGGTAGACATTTGCCAAGATTACTACAGCTGTTTGGCGAACTGAACTGTA
CAGTCTGTACACATCGCGTTAATCGCCGTTGAGCAGCCTGACTAAAGCAACCTGGACAGCTCAGCAGCTCGCCACGAGAGTCGATGGCAGTCAATGGCAG
GAAGAACGCTGCAGACTGCAGCCTGCAGTACCAGGGCGGCTTGACTGAGAATAGTAGTCTGCGATGCACTTTAAGAAATGGCTGCGGATAGTCCGCGAAG
TGACCACCGTGGATGGGGCGAAGACGGGCGAGGGGCAACAGGACCCGCGCTGGCCATTTCAGCTGGGTGCTTGCAATGCTCGAGCTGACTTGCCCGAAGA
TGGCACCACAAGAATGCCTCTGGCAGCGAGCGGTGCTGCAATGCCTGCCAAGTCGCCGCTCGCATGATCTCTGCACGATAACTCCCTTAAGTTTACACAC
AACGGCGGCTCAGCCAGGTAAGCCAAGCTCGACTACTGGTAAGTTTGACCAAGCAGAATTTTCCTGCATCGGCACCGCCAGGCTCAAGAAAAAGCGGGTC
AATGCCATTGCTGCCGACGGACCCGGTGCCAACACAGCTAATACCGGTCACGGTATGATTCATGAGGCGCATTAGGCCTCGAGCGGCTCGAGGCTCGAGT
CGAGCCATTGCATTACCCGAGCTGACGTGACCCAATGCGACTGAGCCCCTGTTTTGATTGGCCAGAAGGTGCTCGCAA