Description :
From Genome Similarity Track
Location :
Scaffold_519:16822- 18224
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_519-snap-gene-0.16Inositol polyphosphate multikinase

Sequence
1402 bases(100 bases per row)
CTACATACTCGTTTTAGTAGTAGCATGGCCTCCCACTTGGTGGTCCATGGTCACGAACTTGGTCGCATCGACCGCATCATTCGGATCCGTCATTACTCTC
GTGTCTCTCGATCTCGTCTGTTGTCACCGCCTCAGATCCGAGTTCTGATCGGCTCAGGTACGATTTCTGATCGGCTCAGTCCTCAAGACACAAGACATCA
TGCGTGTCCTTGTGCTTGGCGGCACGAGCTACGTGGCGCAGTTCCTCCTCCAGCGCCTCCTTCATGAAGCTCACGGTCCTGCAATGGAGCTCGCATGCAC
CATACGTGCTCCATGTGGCTCTGAGCTGCCCTCTGGTTTCGTCCATGCCGATGCACAGTGCTCCGACACCCGCGTCATACGCGTGTTCCATGGCGTAAGT
CTGCTCGACATGGACTCTGTTCGTCGCTCCATTGAGGCGTTTGATCCCCACGTCATCGTCAACTGCATTGGTGCGTTTGTGCGATGGGCGCATTCGTGTG
TTGTCCCTATTGAACCCTCTTGTGCAGCCATGTCGTCGCCTGCAGCGTGTGAGAAGAACCCCGACTTAGCCACTGCCTTGAACGAGGTGATGCCGATCAT
TGCTCTCGCCCATTCGATGATAATGACAATGCAATGCAGCCTGTCGATCTCGTGTCGTATCTCGATTCGTACGCGGAAACGCAAGGGCGCACACTGCGAT
ACATTCATTTCTCGACGGTACGTCCCATGAGAGAGAGCGTGGTCCCCTGAACGTCATCTCAGAAACTGTGATCCTATCGACAGGATTTCGTGTACGATGG
TATCCACCCACCAAGCACGGGCTATCGTGAGCAGGACGCCGTCCTCAGCCCACGTCAGTGTGTCTACAGTGCCACGAAGCTACGCTTTGACAACTTGTTG
ATGCAGAATCGACCACCAAACCTCAGTGTCGTCGTGCTTCGTATTGCCAATGTCGTAGGTCCCAGGGCGCCATTCTTCGTTGACCACGGCACGAAGTTTG
CCGAGTGGCTGTACAACGAAGTCTTCCTTTCGCCTGAGAAGCTGTCGGTTCCGGTGCGACTCTGGAGTGATGAGGTGCGCTGTTTCGTCTACGTCCACGA
CCTCGCTTGGGTCATCGACAAGCTGTTTTCTTCCCCGTGTGAGGCTGCCGTGGAGCTTTTCAACGTCGGTATGTTGTACGGTGCGCATGAAATCATTCAG
CGCCATCTGATGAGTGTCTTAGGGGGGATGGAGGCGCTTTCTCGCGTTGCCTTTGCGGAGCGTTTCCTGGAGACGTTCGATGCGACTCGGACCCATCGTG
AAATCGAGCCAACACAGCGTGCGCTCGTGGATCTTGGATACCAACCACCCCTTGACGCACGCCTCGACTCCTCCAAGATTCTCAAAGCGCTCCAAGACTT
TC