Description :
From Genome Similarity Track
Location :
Scaffold_94:16820- 21757
Sequence
4937 bases(100 bases per row)
TCGCCCGAGGAAGAGACCTCGTGTTGATGGTACGGGCGCAGAGATCGACATAAAACGTAGGATACGTACGCATCCTGCGAGGCAACTCGATTGTGTACGC
ATTGCCTTTGCGATGTAGTACACGAAACGGGCCAATGTAATTGGATATTAGTTTACTACTACCCACATTAGTTACTACGTGCTTAGGTAGATTTACCGTA
GACAGTAGAACTAAGTCTCCAATATTAAATGGAAGAACGTTTACTTTTCCATGTTTTTCAGCTTTCCGTTTCTGCCGGTCCACCGCTTCTCGTGCCAGCA
GGAAATCTTCTGCTGAATCAATTTAGTTTGTTGTATTGCACGTTGTGTGCACTGCTAAGAGGTCATCATCTTTTTCAGCGAGGGTGTTCTCATCCTCGCT
GGTGTAGTCATTGGAGATGCTAAATATACCAGCATCGTCATCCTCATCTAGGTAAGCAATTGTGTCGTCACTATTGCTGAGATCACCAGATTTGATCGAC
ATAGGCAACGTTCGCGTCGTCGATTACCTCACCACGTAATGAGCAAGAGCCAGAACGGTTTTGCTCGAGCGAACACCTCACCCCTTGAATTAGTGTCACA
CTATAAGTGTGTGGGTAGGCGTGGATGGCGTAAGCCGTTCACGAAAATTGCAGTATGCGTTGTCGATGCATGCACGGAGTTGTTGATTGCAAACTCCACC
ATTGTTAGAAATTCGCTTCAATCTGTGAAAGATTGGATGTATCCTCGAAGTATCTCTTCGAGGACGCGGTTGAGGCGTTCTGTCTCACCATCAGTCTCGG
GATGGTCCGAAGTATACATAATCACACGTATTCCGAGGGATCGGAACACAAATTGCCAAATTGCCGCCGTGAACCGAGAGTCTCTCTCAGATACTAGTTC
ACGGAGTAGACCGTGGAGTCGGAATACCGTGTCAATGAAGAAACGGGCACAACCATGTGCTGAGATTGACTCATTAACTGTAGCAAGATGTACCATCTTG
CTGAATCGGTCTACGAACACAAGAATACCGTTATTCTTGTGAGCATCTTCGGGGAAACCGAAGACGAAGTCTATTGAAACAGACTGCCAGCACTCTGCCG
GGATCGGTAGAGGCCGTAGTGGCGAACGAGATGAAGGACTGGGCATCACCCGTTGGCACACTTCACAAGCACGAATGTACTTGCACACAAACTGATACTG
GCGGGGCCAGTAAAGTCGTGACTTACCGTGAGACAAGTCTTTTCACGCCCACGATGCCCACTAGTTGGTGCATCGTGGCACTCATACAAGATGTGCAAGC
GCAAATCATTATGCGTAGGGACGACGACACGAGGTGAGTGGCCGGCAACTGCTGTATATTACAGAAACCCGTTGCGTGTTCTGTATCAATCCGCGGAAGA
TCGATACAAGGCTGGTAAATTTTTGAGAGATTTACGAGATCGAGTCGCCAGATGATCCATTCGTCGCAGAAAAGCCTTATCTTCTGTGTAGACCTTTTTT
ATGTCGTCAAGCATTTTTAACGACGGAACACTAGTGACTAGTGTTGCTTTAGTGGTGTTAACCCCACTGTTGGACTGCGCAGCCGACTCGAAATCGGGAC
GGCGCGACAACGCGTCCACGATGACATTGAGTCGTCCGGGTTTATACTCTGCGGAGAACTTGTACTCCGCAAAGGAGGACAGCCACCTCTCCATCCTTTG
CGAGAGGTGTGGGCTGTTTACGGCCGTGCGGTAATGACGCATGGTCCGTATAGACTACAAACGGCCCATCTCCAAGGAGATAGACGCGAAACTTCGCTAG
TGCATATTTCATGGCAAGACATTCCTTGTCGTGCACTGGATAATTACGCTCAGCTACTTGCAGCTGACGCGATTGATAACAGACGACACGCTCTGCGCCG
TCTGCATCGTACTGCATTAACGCGCAGCCGATTGCGAAGTCGCTGGCGTCACAGACCACATGGAATGGTCTGTCTTGGTCTGCCATCGTCAAGATGGGCG
ATTGCATCAAATTTTGCTTGATACTTTCAAAAGAAAGCTGATAATAAGTGTTCCATGACCGGTTCTCGTTCTTTTTCAGGAGGCGAGAGAGATGAACGGT
CATCTCGGCGTAGTTACGCGAGTACTTGTGTAACTATGCCGCTAGACCAAGGAACTTTCTTAGTCCCTTAACGTCGACTGGCACAAGCCAGTCGGTAATC
GCCTTGATCTTTTCAAGATCAGGGTGTAAGCCGTGTTTACCCACGATGCACCCAAGCAGTGGTGTTTCGCTAGCAGCGAATATTCACTTCTTGAGGTTGA
CATACATCTTATGCTTGCGCATAAGTTTAACAACCTGACGAACGTGAGTTCCATGAACCTCTACGTCTGTCTTTCCTCTCATAGCCCGGCTATGGACGAA
TACATCGTCGAAGTAACTCGGTGTGAAGTCTTGCACCGGTCTCAACAAATTTGTAACACATCTGTTGAAGGTGAAACGGGAGTTGCTAAGCCCTTGTGGC
ATTACTAGCGACTCCCAGAGCATACCGCTCGGGGTGCTTACTGCTTTGTACGGGATGTTCCGTTCACGAATCAGTATCTGATAGAAGCCATCCATCAGAT
CCATGGACAAAAAGATGATACTCTTTGACATACTATCAATGATTACGTCCTTCCTCGGTGTCGGCGTCTTAGCCGGTACCGTTGCAGCATTCAACTTGTT
CAATGCGTGCAATCTCCGCCATCCTTCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGGGGAAGTTGACTCCCTCACATGACCCTCAGCTAAG
AGATCGGCAAAGAACTTGTCGATTGCAAGCACTTGTTCACGAGGCAGTGGCCACTACTTCATGACAAAGTACTTCGAGCCCGGTTTGAGCTCGATTTCAT
GTCGATTGCCTTTATCCTTAGGCAATTTGCATGGTACGGATTTGGGTAACACGTCCTTGAATTCGATCGAATCCTTATACAAAGGATTTTCCTAAAGCGA
CTCCCAAGATTGAGACGTGTATCGCTCAATACGAGTCTTCGCATCGACGACTCTACATTACATTGATGAGCTGCTGAGAACTCGTTCGTTCTCTACATGT
AATACTGTCGACAGAATGTCAGTCACGTACGCGTCCTTTATGACGAATACACAGATCTGCTTGACCTTGCCACTACGCAGATCTCGCAAGAACCGTTTCT
GTTCTAGCGTTGGCAATTGAGTGATCTCCAAAGTCAACTTCGAAGGTGCGATCAGATCAAGTGTATAAGCGCTTACACTTGACCCGTCATTAACCAAGAC
ATTCAATGTCTCGGTTCCTTCCTGAGAACCCTTTTCCATAGGCTGTTGATGACTTATTCCCTCTACGTCTTCTAGCTGTCGTTGCGCTACCACAACTAGG
TCCTCTACTATCTACTCTCTAGCCGATCAAGGTTCATAGTCTAGCCCTGTATGGGCAACTGGTTTATTCTTACATGGATGTCTCCCGCTAGGCGTACACC
CATGTCCCGATCCACTCGACTTGTTCGAGTGGTGGAACTTTGGCGCTGCCTGTGCATCCGTACAGCCGCCGGCACAGGTTCCTCCTCAGTGTGATTAGTT
GTCACACTGTGATCTTGTGCAGTCGTACTAACGACCGTACCGCAAGTGAGGCCATCGCACTCACTCACAGTACATCCCTTGTGGACGCTCCAAGACGTTC
ATCAGATCGCCATCTGATGAACAAGTGGCAGGCATCTTTACAGTTCGATACTGCCAGCTGACCCTTGGCTCGTACTTTATGAGCCAGGGTAACCCTAGGA
TGATATCAAGTTTGCCATCCAAATCAAGTATGATGAAAGCATCATTGTACTGCAAATCTTCTAACGTGTAGTGAAATCCCACAACACGTTTCATCACTGA
TATCAATGCGCCTGTTCCGAGGCGCACCGTCAACGTCGTAGGAAGAGTAAGCGCGCTCAACGAACTTGCGCCTACGATCCTCTAGCAAATGGCAACGAAC
AAAGTTGTTCGACGCCCCACAGTCAACTAAGGCACGAAGTGAAAAATCTTTTGTCACTTCTAAGTTCAAAGTGGTGAAGGGTACCTCATCACCAAGTGCG
GAGACACAAAATGATTGTGAGTCTGGAGCAATTTTCATCAATAGGTTTTCAAATTCAGTTAAGGTTGCTGGATCAGTAGAGCGCTCCGCCTCTACTGACC
ACGACCGTTTTTTGATGGTCTGCTACGATGTTGTGACTTCGCAACATCGTTGGACTCGGGTCCGTTGTGCTTCTTGGCAGACGGTCTATCACTTCGCTCA
GTGTTATGAGACACTGGGCGTGAAGCACTACACTCGTAGGCATAGTGTCCTAACTTCTGACAGCGGTTGCACTTTTACAATCGCTTACTGCTTGAAGAGC
GAGGTCTCTCGCTCTCGACACTGCAGAGATCCATTGGTTCTGGACCTCCCGCCTTTACTCGTCTCGAAGAACCATAGGGGGTCAAGCTATTGTGAGCCTG
TCTCACGCTAAAGTCCTCTTGCATCGCAGTTGTAATCGCTTCCTCAAGCGCCTTCAGCGCGATGAGGAATAGGTGGTCCCTCACTGGACCATCCATAAGG
CCTTATAAGAATATCGTGATCAACACAAATTCACTTACAGGGTTCGCTACCATTCAACTTGCAAGGTAACGAACGTGCTGTGCGTAAGCGTTAACGTCAC
GCGTACCTTGTTTTATGTTCAGGAGATCTGAAAGAGTCCTGAACTCAGCTCTTGGCGGCTCAAACGTTTGGCTGAGAAGAGTCTTAAAGACCACAAACGA
TCCAAATACGTTGGATCGTGTAATTGAAGATTCAGGGCCCAAGTTCTGGCACGCCCTGACAAATTCGATTTGGCAAATGCGGCTTACAATTGCCCATCAA
TGATGCGACGAGCCTTTATGGCGTTGCTCAACTCTAC