Description :
From Genome Similarity Track
Location :
contig_84:168172- 172781
Sequence
4609 bases(100 bases per row)
CCTTCCCCGGAATTCGGAAGACCACTTGCGTGCTAAGGAAAATCTCTCTCTGTTTATCCATTTAGAACTACGTGCCTATCCCCCATCTCTCTTGCGTATC
TCATGATTGCTGACATTCTTGGACCTCCGATGTGCCGGTATTTGTGGTACGTGCTGATCTGATCGGCTGATTTGTACCCATGTCAATCTGATCGGTCGAT
CGGAACCCATGTACCCAACATGTGGTACCGCGACCAAATCTGCCAAGATCGGAATGATGGTCTTCACATTCACCATCCGGTTGTCCGACCGTTGATGCCG
CCCATCCCAGGTCCAAAGCCATCCATCCGTACCCATCGACCAATCACCTGGTCGGGCACGATCAATCCATCTCCAAAAACTTCTGGTCACTTCTCCACAA
CCGCCCTCTGTGCGAGAGGCGATTGTACAGCACTCAACTCTCGCCACAGTCTCCAACTTGCCGCAGTGCACCTACTCTCCGACCGGGTCTGCTCGTGCGC
CGTTTACGGCCATCTGCCATCTGCCTCCGCCATGTCATCCAGCGACCGATCGTCGGCAACCCCTTCGCCTTCATCCGCTTCAAGCACTGCTTCTCCTGAT
GTAATCGACGCCGAACCTGCGTTGTCTCCCGTCGTCCCAGACATTACACGCGCTATCCCCTAGGCATTGCGCCATGGCACGCTGCGTGGGCTCAGTGCGT
ATGCTGCATCGCCTCCAGCCGGTATTACACCGGCTGCGCAAGCTCCGGCGACCGCCCCCGTCCCGATGTCGATCACTACGTTATCCCAAGCGGATCGCGA
TACACTGCAGGCGTCGCGCGCCACGTTGGACCGGATACTCGGCCACCTGAGCGATCAAGATGCGGTCCAAGGGATATACGCCGACTTGGCGCAAGATCAC
GTCGCCCTGCAGACTCGAGCCCACGAACTGGAGCAAGAGTTGGACCGCGTGTACTCGTCGTCGACGACCTTCGTGCAATCTGCTCAGGAGCAGTATTCGG
CGCTGTTTCGCGATCATCAGGGTACGCGTCTCGCGTTAGCTGATGCTCACAATGCCCTGGCAAATCGACTCGACAACAGCCGCGCTCTCGACACGGCTCG
CACGTTACTCGCCGCAGAACGTCGATCACACGACGAGGATGTGGTATTCCTTCACGACCGGATCGGTGCTCTCGAGCGACAGGTTTCCGATCTGCAGGCG
CGAGTCAACGCCCCATCGCCTCGAGCGCGATCAAATCGATCTTCTCGTCTCAGCCGTCACATAGTGGTCCAGCAGCGAGACTTGGTTGAGTTGGGTGCGT
GTCGCGATCGGGTGCTTGCTGACCTACAGCGTTCCCGTGGTGATCTGCAAACGTCTGAGTCGACTCGCCGCCAACTGGAGACCAGCGTGCGAAACTATGA
GACCCAAGTCAAGAGCCTCGAAGACCGCCTTGGTGACCTTCAACGCGACATGGACCGCCAACTGTCGGCTACACATCGTCATGTGGCGCGTAGCAACACT
GAACGCGACCAGCTTCGCCGTCAGGCCTCCGACGCCTCCACTCAGCTCCAAGCGGTCAGAGATCAACTCCAACGGACGATCACCGAACGCGATCAGGCCG
CGACTTTGCTGTTGTCCTCTCGTACGTATGCGTTGCCTGCCCATGTCAACTTCCGTGCTAACTGTATGTCGTTTCGTTCTCTTCCAGGTTCCACTGTGGC
TTCTCTGAGGGCTGCCATCGCTCGCTTGGAAGGTGAAGTGACTCGCCTCCAGGGCGATCGCAATCGCGTGCAAGTTTTACAGCGGGAGAATGCCACCCTG
GCTGGAGATTTGACCGCTTCCCGTGCTGATCGCGCGGCACTGATTGATTCGCGTGATCGAGCTGTCCGTGAGTGTGATGCCATCCGCCAACGCGTGGCAG
GGCTAATCTCCTTCGTTCAACCCAGTGGTAATCCTCAAGATGAGAGTGAGACCGACGCGAGGCCAACAACGACGATGATGTAGCTGACGAAGATAACGAT
TATGGCGGAGATGCTGATGTCGACGAAGCCAGCGTCGAGGATGGAAACGGTTCGCGGCGTTTGAATCTGCAACCTTCTCGTCGGCGGCGTACACGATCGT
TTCACAATCGCCTTCGCCGCCATCACGACGTTCTCGCCACGCGTCTTTTGGTCGTAGCCACGATCTCCATCACCAACTTCCTCACATCATTCTGGACGAC
GACTTCGGGGAGGCAGCGGTAGCAGAGCCACTTCCCCACAGGCTACTCCCGATCTGAGTGATGATGAAGAAGACATTGGCTGCGCTTTCTCGATCTCGTG
CATCTGATCGTCGGCGTCGCAATCTCGCGACTCTTCGCCCCGAGGGTCACCCCATCGGCCGATTAACGTTGGTTCTTCTGGTTCCGACCGAGGGTTCGGC
AGACGGCGCTGGTGGACCTCCTGGTGGTTCACCTGACTCTCCGGGTAGCCCTGCCGATTCTCCACCTGGTGGTGGCTCACCTGATTCTTCAGGCAGTGAC
GGCAGCGTACCCCGTCGCGATCGTACGCATCGGATACTATACTGGGGCGTCAGGAGTTGATCGCTTGGAAGGCACAACTGCGCCTCGCGATCAATGGATT
CCTGGATATCGCGAGCGCGTGAGGACGCCCCGCTGCGGATGTCGCCCCGTGGGACGCTCGTACATACGTCGTATCAGTGTCCTCGAATTGGATTTGGACT
TGCTGTTCCACCACTTCTGTCGGCCACGTAATTGGTTGATCCCTGAGCGTGCAGCTCGTGCTCCACGTGATCATGCCTGGCGGTCAGATCTGATTACCGC
GGCTCACGTCCGGGCGTTGTACGCAACGCGCCCCTGGGAGACTCTCCACACTGCCGTCACCCCGATTTCGTTCGTGCTCGTGGGTTGGTTTGCAACCATG
GCTCGTCAATATGCGGACTGATACACGAGCATGGCAGGCCGTGTGGGAGTCATTGCACTACTTCTCCATCAGCACCAGCAGTCATCGCGGGGACGTTTAC
CTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAGTTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTC
GGTGTGATTTGGACATTCTGCTCGACCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGGAGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGC
GACGTCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGGGTCCAATACCGCCACGACATCCGATCGGACCCCGCGCAACGTATGCGCGT
CTTCGTGGCAAATTCGTCATCCCACATCCCCTTAAACGTATACCCAAGTGTCAGTCTGCATGTAATTCACTTTTCATCTCGTTTTCTCCAGTGTTTCCCT
TGATCGGGTCGATCGAACCTCGATTGGTTCTTCTCCCTTCACACGACTTGTGTTGTACATAACTCTTCTTCTTCCTGAGTGCAGCCACCTGCCATTCACT
TCACTTTCGCAGCGATCGTCACGAGTTGTCCTCCTTCTTCCTGAGGGGGGGGGGGGGGGGGGTGCAGCCCTACACCCATTTTTACTCCCACTCGCAGCGA
TCGCTACGAGTTGTCCTCCTCTGCTCGTGCGATTGCATCCACTCCGAAGCGATTCCGTCTAGTACGCTCGCGCTCAAACTCGTGCAGCAAGCCCCGCAGT
TGAGGTCAGCCTCATCGACCCAGACGGTTCGGTGTATCCCTTCCAGAAGACCTGGAATTCCCGATGGACGCGTCCATATCTGTCTTACGACCCGATCGGA
CATCTGCGATCCGCTCCACTTCAAACTCGTCATCGCTCCTGTCGCCTTCCCAGCTGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCACTCTC
GTCCGTCGCTAGCGTCACGTCAGGGCGATCAGAGAAAACCTTCACGGCCTTGAGCTTCGAGACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCC
ACCTCTAGCCGGGCCGCGTAGGGGCAATCATCTCGCGCACCCGGAACGGTCCGTGCCACATTTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATC
CAAATATAGCCACACTTGCGACCCGGCCTCAATCTGGTGCGACCTTATCCCGTCGTTGTGGCGATCGGCCCTCGCTTGGATCGCCTCCTTCAGGCGCGCG
TTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCTGCGCGGCTCGCGGTCGCGACGTCGATCGTGGGTCCCAGCCATGGACA
AGGTAGAACGGCGTCTCTCCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTACTCGTCCCAGTCTTGCTGATTCACATCGG
CGACGTACATCTTCAAGGCGCGGGTAAGCGTTTGCACCATTCGCTCAGCGGTACCGTTTGCTTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCC
CACTATACGGCTGAATGCGCGGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCC
TCGTAGTCT