Description :
From Genome Similarity Track
Location :
Scaffold_2456:1681- 2790
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2456-fgenesh-gene-0.0HECT ubiquitin ligase

Sequence
1109 bases(100 bases per row)
CTTTGTTCAGTGGCGATACGGTGGAGCACCGCGTGGACGCCGCGACACGAGAAGCGGAGGCGGGCTTTAAAATCTGTTCCGGGTGCGAGTTTGAGAACTT
CAAGCGCTCAGCGTACTGCTGTCTCTGTGGCGAGAAGCTGTTGAAAGAACCGGCATTGGCAACAACAAGCAATAGAGCTCGACGGAATGAAAGCCAACTG
GAGACGCCGACGCATGCGCGACAGCTGAGAACGCAGCAGATCCGCGTGAGGTTTGTAGTGTCGCGTATTTCACTCTTGCAATGCGTTTTAATCCGTCTCA
GTATGCTCATTTTATCGTTCTTGCGGCATGCGATCATACAGAAAACGCAAGGAGTGGACTCGCAAGCTGGATGTCGATGGCAATATGTTCTGGTATCGCT
CGTGCCTCAACGCCGACGAAACCGCACCATCATCGTCGCAGTCGCCTGGTTTTTGCGTCGCTTTCAAGTCACCATCAAAAGAAAACATGCCGCCGAAAGA
AGACGGCGTCGAGACGGTCGCGCCTGGTCTCATCAAGATGGACGACTCACTGCAAATGGTACTGCTGAGCTCTTCGGACGTGAACCCCGCGGTATCCCCC
ATTGGAAGCGCCACGCTTCAATCGAAGGACCGCATGAAGGAGGTTGTGGAGTTTGCTGCGAAAGATTTCCCGACGAAATACGCGCACTTTGTTGTGAGCA
CGGCGGCGCTGATCGTTCCCGCTGAGGTGGCGTTCCTCAAGCTCTCTATGCACCGCGATTACATGCTCGAGGAGTCGATTGACCACGTGGGCTGCATTAA
GGAGAAGAACATCCACTCGTACATGCGCATCACGTTCTTGGACGAGAGCGGTGTGGACGCCGGCGGTGTGCACCGCGAATGGTTCATGCTCTTGGCCGAG
CAGCTGCTAAATCCGACTCTGGGGCTGTTCCAGTGCACGAACAAGAGCGAGCAGAGCTACTACCTCAACCCAGACTCGGTGCGCACAATCGGCAAAGAAT
ATCTCGCGTACAACTACGCGGCAGGAAGACTCATCGGCCGCGCATTGCTGGAAGGGACAGTGTGGGGGTTCCACCTTGCGATGCCGCTCATCAAGATCAT
CCTGGGCAT