Description :
From Genome Similarity Track
Location :
contig_40:168086- 169322
Transcript NameFunction/comments
g8647.t1RAW28632.1 Succinyl-CoA ligase [ADP-forming
g8648.t1hypothetical protein
g8649.t1POM81476.1 CenpB-DNA-bind domain containing hypothetical protein [Phytophthora palmivora var. palmivora

Sequence
1236 bases(100 bases per row)
CATCCACCAGAAGGGCAAGGTCGGCATCGTGTCGCGCTCCGGCACCTTGACATACGAGGCCGTGGCGCAGACGACGGCGCTGGGCCTCGGCCAGTCCACG
GTCATCGGCATTGGCGGTGACCCGTTCAACGGCACCAACTTCATTGACTGCCTTGAGCGATTCACCAACGACCCCGAGACCGAGGGCATCATCATGGTGG
GCGAGATTGGTGGATCTGCCGAGGAGGAGGCCGCCGAGTGGCTCATGGCCCACGGCGACCCCAACAAGCCCGTGGTGAGCTTCATTGCCGGCACGACGGC
TCCCCCCGGACGTCGTATGGGCCACGCTGGCGCCATTGTGTCGGGCGGCAAGGGCACGGCGGCTGGCAAGTTCGCCGCGCTCGAGGCCGCTGGCGTCGCG
GTCACGCGATCGCCTGCTCGTCTTGGTGTGACGCTGTTCGAGGAGATGAAGAAGCGCGCATAAACTACCAGCCCATGTGCATTAACAGAAGGAGGCAGCG
AGCTCGATCTGCAGCGGCGAAGGAGCTGAGACGAAGACGAACACGCCAGTCACTGGGTAGCTGGGTCCGACGTTTGCTAGAGGCGAGGTCCGTTCCTCTC
CTGATTTAGTCACGTTAAACTACAAACAAAAGAGCATGAAAAACTCAATGGCAACTTCAGTGTACTCAGCGTTATCGCTAGGCTAACAGCTTACAGCTGG
GCGTCCTGGTACATCCACTTGTCGTTCTGGAGCTGCTGCGCCTTGCCGCGCAGACTCGTGAGCGTATCCTCCAGCAGCGCTGCCAGCATGAGCACCACAA
ACGTCTCACCCATCAGCACTCGACTATCGATATTGTACCTCCATTGCGTCTGAGCTGATGATGTCGCACCATTGCTCAGGTCCCTGGCCGCCTCCTCCTT
GGCTTTGCGCTTTTTCTCCAGCAGCAACAGATCCTGCGAGACTGCAGACAGCATCGTCAGATTAATACACAGTACTAGAACATCACTCCACTGCAATAAC
CTACTGCTGTCGCTCGCAGGCAGCGCGGACGCACTCGCCGACGCCGTGCTCCACCGAGAATTCATCGCGACGTGGAACTTCACATAACATTAACACAAAT
ATGTACACCAATCGTACATCAATCCTACACAAGTCTCACTTGACGATTGTCCGGATAAACGATGAGCGACGCCGAGGTTACCACGCCGCATCCGGAGCAG
GATGCCCTCACTGTCGGCGATGAAGCGGCCGCCGGC