Description :
From Genome Similarity Track
Location :
contig_40:168085- 169321
Transcript NameFunction/comments
g9044.t1RAW28632.1 Succinyl-CoA ligase [ADP-forming
g9045.t1hypothetical protein
g9046.t1ETI47111.1 hypothetical protein F443_08590 [Phytophthora parasitica P1569

Sequence
1236 bases(100 bases per row)
TCGTGTCGCGCTCCGGCACCTTGACATACGAGGCCGTGGCGCAGACGACGGCGCTGGGCCTCGGCCAGTCCACGGTCATCGGCATTGGCGGTGACCCATT
CAACGGCACCAACTTCATTGACTGCCTTGAGCGATTCACCAACGACCCCGAGACCGAGGGCATCATCATGGTGGGCGAGATTGGTGGATCTGCCGAGGAG
GAGGCCGCCGAGTGGCTCATGGCCCACGGCGACCCCAACAAGCCCGTGGTGAGCTTCATTGCCGGCACGACGGCTCCCCCCGGACGTCGTATGGGCCACG
CTGGCGCCATTGTGTCGGGCGGCAAGGGCACGGCGGCTGGCAAGTTCGCCGCGCTCGAGGCCGCTGGCGTCGCGGTTACGCGATCGCCTGCTCGTCTTGG
TGTGACGCTGTTCGAGGAGATGAAGAAGCGCGCATAAACTACCAGCCCATGTGCATTAACAGAAGGAGGCAGCGAGCTCGATCTGCAGCGGCGAAGGAGC
TGAGACGAAGACGAACACGCCAGTCACTGGGTAGCTGGGTCCGACGTTTGCTAGAGGCGAGGCCCGTTCCTCTCCTGATTTAGTCACGTTAAACTACAAA
CAAAAGAGCATGAAAAACTCAATGGCAACTTCAGTGTACTCAGCGTTATCGCTCGGTTAACAGTTTACAGCTGGGCGTCCTGGTACATCCACTTGTCGTT
CTGGAGCTGCTGCGCCTTGCCGCGCAGACTCGTGAGCGTATCCTCCAGCAGCGCTGCCAGCATGAGCACCACAAACGTCTCACCCATCAGCACTCGACTA
TAGATATTGTACCTCCATTGCGTCTGAGCTGATGATGTCGCACCATTGCTCAGGTCCCTGGCCGCCTCCTCCTTGGCTTTGCGCTTTTTCTCCAGCAGCA
ACAGATCCTGCGAGACTGCAGGCAGCATCGTCAGATCAATACACAGTACTAGAGAATCACTCCACTGCAATAGCCTACTGCTGTCGCTCGCAGGCAGCGC
GGACGCACTCGCCGACGCCGTGCTCCACCTAGAATTCATCGCGACGTGGAACTTCACATAACATTTACACAAATATGTACACCAATCTCACATCAATCAT
ACACAAGTCTCACTTGACGATTGTCCGGATAAACGATGAGCGACGCCGAGGTTACCACGCCGCATCCGGAGCAGGACGCGCTCACTGTCGGCGATGAAGC
GGCCGCCGGCTTGAAGCGCAAGCGCGTGGTGCTGTC