Description :
From Genome Similarity Track
Location :
Scaffold_109:168082- 190518
Transcript NameFunction/comments
Physo_142190hypothetical protein
Physo_142191hypothetical protein
Physo_142192hypothetical protein
Physo_142193hypothetical protein
Physo_142194apoptosis-inducing factor, putative
Physo_142195apoptosis-inducing factor, putative
Physo_142196hypothetical protein

Sequence
22436 bases(100 bases per row)
AGTTCGACAGCACCTGCGCGGCGTCCAGGTCGCATTCTACGGCGACCACGTCGTCCTCGCTGAGTAGCCCCGACGCAGCGCAGTCGACGTCGATGCTGTT
GTTGTTCTCATCGGCGCGAGCATCCGCTTCCAGCTCAAGCTGGAGTGGCGAGATGGCGGCGTCCCAGTCCAGCTCGACCAACGCGGTCAGCTCGACGGAG
TCAAGCGGGTCCAGCAGCAGCCCATCGTCCGTGTTGCAGTTGTCGCCCAGTGCCCATAGCGGCTCCAGCACGCAGTCAAAGCTGATTTCAGCCAGATCGT
CGACGGCGCACACGTCGCGCGGCGACATCTTCTGCTTCTTCGCTGCGCTGGACGTCTCGGGCGTCGCAGCCAGAAGGCTCCGGGGCCGCTTGGCAGACAT
GGTCGTGGATCTCGCCGTCGCTGCTGCTGCAGCAGCAATGGTCGGCTTGTTCTTCTTCATCCGGCTCACCAGGACGGCGAGCTCCGACACGTGGCACCGC
ACGAGCACGTCGTGGCTGAAGGTGGCGACGCTGGCGCGCGTCTTGGTCCACTTGTGGAAGCCGAAGTTGTTGAGCTGGCGCTGGAAGCTGGTGAACTTGC
CGTGCTTGAAGTACTTGCGCAGCACCTCTGTCTCGAGCCGCGGGACGTCGTACACCTGGAAGTGCGACCCGTCCGCCGACCAGGAGAGGATGCGCTGGTC
TTCGTTCTGCAGCATGTCGTAGACGGCGCGTACGAAGCGAGGCACGGTGGCGTCGCTAGCAGTAGGGTTCATGTTGAGTTGTGTAGTTGGCTTTGGTGGC
GAGAGGTGAGAGGGGAAAGTTCCGCCGCAATGGTGGTGGTGTGTGTTGTGTGGGTCGAGCCCGATTGAGTTGTGACGGAGATGTCAAGTGGCTCGAACGA
CGAGGCATGCCTGCGGTACGCACGGGTGTTCATCCGCGCCAGACAGATAGGTAACCCCCTGGGCAAGCGCGGTGCGTTGTCACATTTGGCAAAACCGACC
GACAGACCGGCACACATGGCTTGACGGACACCCGGACTAAGACCTATGAACACTCGAGTAGGCTTCTTCTGCTGCTGCCGCCGCTGCTGCTGGTCCTGGT
CCTGCTGTCGCGGCCTCAGGTCGACAGCTCTGTTGGAGGGGAACTAACCGAGAATGCAAGTGGCGAGCGCACTTCGTCAAAAGCAGGTGACTGCGCTTTG
AATAGCTACGCGAAAGTTTCTTTCGTGACGACACGTCTGAGTCGCCCGATCGAGGTTGAAGTTTTCCATGTGTTTACACTGGACCCCGCGTTGTTTGTCC
GCCTGCTTGGGTGCTCGCTCGCTGCCTCACGAACTCCTCGCTCGGAGGTAGAAGTGCCGACAGTAGAATAGATGGGAGGGCGGTCGCGTACTCAAGTATA
CGCTTGCACTACAGCCACTACTGTGCGAAAGTGTAGCCATGTCGACAACTGAAGTTGTAGATGAATTGCAGCAGAAAACGGCCAAGATACTGCTCGACCA
CCGAAACACACTTCAGCACCAGCATGTTCAAAGAAAATACGTACCCTGCACTCGTTGCACGAAGCCACACGAAGGTATATCGATTCGTTCAATAGGGTGC
TCAATCAAGTATGGCATGGATGCTCATAAATTAGTTGCATTCAGTTTGTTTTACTACTCTACACAATACAATACTACGACACTGAAGCACTATATACCTG
CACCACCCACAGTGCACAGGTTGACGTGCGTACACGCTGACAGCGGTGCAAACCTACACGAACAGCAAGCTGTCGGCGTCCAGGGCGACGTCAATGCCAA
TGCTGGTGGCCATATCGAAGTTAGCGTCGATGGCAAAGTCAGCGTCGTCCGAGTCGGAGGCGTCACCGAGCAGCGAGTCCAGCTCGCAGTTCGACAGCAC
CTGCGCGGCGTCCAGGTCGCATACTACAGCGGCCACGTCGTCCTCGCTGAGTAGCCCCGACGCAGCGCAGTCGACGTCGATGCTGTTGTTGTTCTCATCG
GCGCGAGCATCCGCTTCCAGCTCAAGCTGGAGTGGCGAGATGGCGGCGTCCCAGTCCAGCTCGACCAACGCGGTCAGCTCGACGGAGTCAAGCGGGTCCA
GCAGCAGCCCATCGTCCGTGTTGCAGTTGTCGCCCAGTGCCCATAGCGGCTCCAGCACGCAGTCAAAGCTGATTTCAGCCAGATCGTCGACGGCGCACAC
GTCGCGCGGCGACATCTTCTGCTTCTTCGCTGCGCTGGACGTCTCGCGTCGCAGCCAGAAGGCTCCGGGGCCGCTTGGCAGACATGGTCGTGGATCTCGC
CGTCGCTGCTGCTGCAGCAGCAATGGTCGGCTTGTTCTTCTTCATCCGGCTCACCAGGACGGCGAGCTCCGACACGTGGCACCGCACGAGCACGTCGTGG
CTGAAGGTGGCGACGCTGGCGCGCGTCTTGGTCCACTTGTGGAAGCCGAAGTTGTTGAGCTGGCGCTGGAAGCTGGTGAACTTGCCGTGCTTGAAGTACT
TGCGCAGCACCTTTGTCTCGAGCCGCGGGACGTCGTACACCTGGAAGTGCGACCCGTCCGCCGACCAGGAGAGGATGCGCTGGTCTTCGTTCTGCAGCAT
GTCGTAGACGGCGCGTACGAAGCGAGGCACGGTGGCGTCGCTAGCAGTAGGGTTCATGTTGAGTTGTGTAGTTGGCTTTGGTGGTGAGAGGTGAGAGGGG
GAAAGGTTCCGCCGCAATGGTGGTGGTGTGTGTTGTGTGGGTCGAGCCCGATTGAGTTGTGACGGAGATGTCAAGTGGCTCGACCGACGAGGCATGCCTG
CGGTACGCACGGGTGTTCTACCGCGCCAGACAGATAGGTAACCCCCTGGGCAAACGCGGTGCGTCGTCACATTTGGCAAAACCGACCGACAGACCGGGAC
ACGGGGATTTGCGGGCCCCTGGCGGTAAGATCTAACGACACTCGCGAGCTTCTTATGGTGGCAGTGGAACTGCTGTTGTGGTTTCCGGTCGACTCGATCT
GTTGGCAGGGAACTCACCATGGTCACAACCGGCAAGTGCGTTTCCAGCAAAGCACGTGCCTTGATTTGAATCTTTACTACTGTAGGCGTAGTGTTGGTGT
TGCTGTATCTTGATGAATGCTCGAATCGCTTAGGTGCCGTTCTTGAACTGTTACAAAATTCTTGGTGCACGGGGTTCCTACAGGGGCGCGGTTAGGAAGG
ATCGCGCTTGCGTACCTTTGAAGTAGCAAAATTTACGGAAAGTCCAGTGTGGTTAGCTAGGAAATGGCATGCGAGTGCACGTTCTCGAACATGGAAGTGT
AGCCATTTCAGAAAGCGTCGAAAGCACGTGCCTCATACGATCACCAAGAAGTCACTTCAAGGTGGTACAGTAAACGTGCAGCGCGCCTTTCAATACAGTA
GTATACTAGCCAAATGCAGCAGCTGTGTACTTCACTAGGCGCCATGCGCTTTTGGGGCCAAGGGCGCTGCAGCTGCGGTTTCTGCGCATTTCATTGTTCA
CCCAGCGCTTTCTGTAGTGAAACAATCCCCTGTGTATTGTATGCTCCGTCACAAATATAGCCTTCTCTGCTTCTCGTCACGAAAGAGACTAAGGATATCA
AAGAAGCTTCTGCGCCCCCACAACTGAATTCACATCTGAGCAGCAACTCGTAGTACCGACTTAGTAACAAACATCGGTGAGATGCGCTCCAGCGAGAAGA
TCGTCGACGAGGTCCCTCGGTTCGTCCGAACTCTCTACGACATCTTGCACGACGAAGATCCGTTCATCCTGTCGTGGTCCGTGGACGGGTCTCACTTCCA
GGTCTTCGACGTGCCGAGACTCGAGCGTGAGATCCTGCCCAAGTACTTCAAGCATTGCAAGTTTGCCAGCTTCCAGCGCCAGCTGAACAACTTCGGCTTT
CGCAAGTGGACGAAGACGCGGGCCAGTGTGTGCACCTTCAGTCACGAGTTTCTCCACCGGTGCCACCCGTCCCAGCTAGCCCCGCTAGTAGCTGAGATGG
AGGCGCAGAAGGCAGCGATGTGCGCAGCGAACACTCACATCGGGACAAAGCGCTTCCGTGACGAAAGCAGCACCGACGAGCGCGTTCTTCCCAAGCGACT
TCACACCGAGGTAAAGCACGAAGACGAGCGCGAGCCAGAACAAGAGATGGCTTCGTTTAGTCCAGAGAACTTCGTCAACGAGTCGGGGCCATTGGCTGGG
TTTGATGCAGCGGATTTGGCTGCGCTGGATTGGTCACTGGTGACCGATTCTGGTCGAGAAGATGAGCTCAGTTCTCTGCTCGAACCGATTCTAAACCCAG
TTGCGCCTATTGTACAAGCCGAAGTAGGTAGCAGGATTGCGTACGACAACACCGAGGTTGCTTTCGAGACGTTGCCACCGCTCGACACCGAGTACCTTGG
CGATTCCTGGACCGACATTTTCGACGAGGTGTCCTTGTGACTCGGAGTCAGAACCACGTGGTTTTTTTGTATGATTTTTTATCGACTGTATGCGAAGGTA
GATTTTCGTTTTTCAAATGTAGACATAGGATCAACTTACAAGGTTGCCTGGCGCCTATGCAACATGAAAAAAAGCTGATTCAGGCGTTGTTTCCTTGCAC
TATACGTTCGTGGGGGTGTCAATTCGTTTTCTTGGTTAGAGTTTGAGGGCGCAGTGCAGGCTGTGGGGTTGGACAACTTGCAGCAAGTAGCTCACATGTT
TCTGCTAGGTATACGCACCAGGGTCAACACAGTTCGCACCCGCTTATTCAGGATGGTGTCAGGCGCTGTGCTTGGGTAATCGAACGGGGTCTTAAGTGTC
TCGATACCATCATGACCACACTGAAGAGCAGATCGCACGAGATGGAGAGTGAGGTCGAGTTGGGTAAAAAGCTGTCCAGGTAGAACTTGGGATTTGTGAG
ATGCTACAGCAGATGAAAATAGTTTTTCTGGAAGGTGCGGGAAGTTTCAAGGTAGTGTAGTTCCATAGAAAGTGAAACCACCGCGAAGGTGGCCGGCCGG
CCACTCTCCGCCGCCCCACGGAGCTCATTCCACAAGTTTCCGCCTCGGTAGCTAGTTTTAACCCTCCACGCCACGCCCTTGGCAGCGGGAGGCGCTGCTA
ATCAAGTCTTCTTCGTCGCCGCGGTGCGGCATGATCCCCAAAGCTACATCAAGAAAGAAGGGGATTGATGCCTATCAACTGCGTCGCTTGTGTACGCTCG
CACGGCCACCGTGCGCCCACTAACGTATTGTGCGGTGAATCTACAAGAATACCGTCCTTTGCCGTGTATTCCATCGGACGTGGTGGCATATTCCGTGGAT
ACATCCAAAGAGGTGGTCAACAAAACCCATTCGGGTTTTCGAGAATGTCATCTTCAACACTAGGAGTTTAGCCCGTAATCTGTCTGCCTCTCTGTCCTCA
AGTCGCTTGGTTTACGGGCATGCATGCTACGGAGGCGTTGATCGGCTGTGGATACTGTTTTCGGCCACGCCATCGAATGGGCGATCCTTGAGGCGACAAA
ATTGAGCACCGAGAAGTGCCGCTTCCGCCCAACGGAACAAGAGGAAACTTGCACATACATACCGCCTCGTCGAAGAGGTGCATTATTCTGGTGTCACCAG
TTAGTGAATGCTCACTAACTTTTCTTCGGTCGTTCCCACCTCGGTTGGAGGAAATTGCAATAGAATCACAGTGAGACTTCATAAACGAGATCGATGTTTC
GGCACTCGATAGTTGATTCATATTGATACTCCGACTCCTGCACACTACTTCGACGACACCACAAACTACATCTAACACGAAAACTACCTTACTATCAATT
CCGGTAGCCGTTGATCACTTGATCGCTTTGTGTCCAGCCCTTCCTCTTGAGGCCGGACGCACACCAGTACTTCAGTCGTACTGGATGCGTTTGGTGGCAC
CTATCGATGCCAAAACGCCCGGTGGCGTTTGATTACACCCATTGCTGTGGGTTGTGCCAGAACGCCAGGCTGTGGCCCGGGTGGCGCTTGAAAAACTGGA
TCGGCTCGACCTTGTCGTCCACGTTGCGGTGGACGTACATGGCAAGGCAGCCCGGGTGGCTTTCGCGCCGAGACGGCAAGAAACCCACTGTCCTCTTGCG
ATCGTACACACTCTGCAGGTAGAACTTGGACGTTGAGGTTACAGGTGTGCGGTCGGGGACACCAGTGATGACAAACTTGGCGCGTACGTCAATCTTGTTG
CTGAAGGTAAGCTTCTTGGAGATCTTCTGCATACGCAGCACTGTACCGTCGGTGCGGGCCAGCGAGATGCAGTCTCCGCCGCGAAGTAACCCATCTGTGG
TGTGCCCAATGATACGGAGGGTATCTGCGTCCTCCAACTGATCGTAAGGCTGAATACCGTAGCAACGCACACGCCGCGAGAAAGGGTTCTTGTGGCCAAC
TCCTCGTCTCTTCGAATGTCCTTGCACTTGGGTGATCTGGCCAGTGGTCGTCTTGAATGCCAGGTGCAGCTCCTGTCCGTGGTACATTGGCACTGAGGAA
GGCTCATTGATGAGCTGGCGAGACCCAGGTGCAGCAGCTCCCGCAGCAGCGGCGGCGCCACCGTCGGGTACTGTAACGTTGCGACGAATGACTTGGCTCA
TCATACGAGGCGGCGAGCTCATGCCGCGAATGTTACGGGCCGAGCCTCCAACTTTCCTCGGTACTTCCGTGGTGCGCGAGCGCGGGATACGGCGAATGAG
CGAAGCCTCGAAGTTGGCCAGAGCTTGGGAGCGTGTCTGACGAATGCTGTCGATGTCCACCGATCGGTTCGTGGGGTCCTCGCCGTAGTCATCCGTCGTG
GCGCTGCTGGCGTCGTCGTCTTCGATCTCGCTCTCGCTTTCGAACTCGTCGTCGCTCTGATCAATGGCCAACGGCGACATACCACGCTGTTGGTTCTGGT
TGAAGATGAGCACGTCGCGCACGTGTGACGGGATCGGAGGCGTCTCGTACTCAGTCGGCAGCATGTCCAGCGTGAGTCCTGCGGGGATCGGGGGCGTGCC
AGCCATGAGACTGTTGATGTCCTCGAACGTCGGTCTCAGACTATCGAACGTCGGCCTCGAAACGCCAGTGTCCTCGAATGTCGGCCTTGACTTGCCGGTT
TCCTCAAACGTCGGTCGCACACTACCGCAGTCATCGAATGTGGGTCTCAGGCCGCCAGTGTCCTCGAACGTCGGTCGCAGGATGTCATCGCTACCGTCGG
TGTCCACGTCGAGGAACGAGTTAGCCAGGTCCATCATAGGCGGCGGTGTCATAAGCGGTGGCGGAGTGTCCAGTACATTCGGCGAGGAGGACACACTGGT
CGTGGAGGACTCGGTCATCTTGTTGGGCGAGTCCGCAAAGTGCTCCGTCCAGCGCATCGTCATGCGCGACAACGGGTTCAGGATGTTTGACAGACGCACT
GACGACGATAGCGACGACGTGGTGTGCGCACGGCGGCGAGAGATCGGCTCGTCCTCGCTTAGTACGGCGATGTCGGCCGCGTCGTCATTCTGAACCAGCT
CCTCGACGTTGTCATAGACAGCTGCGGCGTGCGCCTTGTAAGGCGGCACTGGCGGGGGCGCGCGCTTGTACGGCCGGTTGCGGATGGCCGGAAGACCTTC
GTCGCCGACAGTTTGGCGACGCATCCGAGGCGGCGACGCCGCTGGGTGCACCGTCACCTTGCAGTACTTCGGGTCCGCGCACATGGTCATTGGTACAGTC
TAACTTGGTCTGCGCTCGTCACAGATCCAGGCAGGCAGAGTCCTGAGCGGCACGGGTCAAGTTGGAATGTAACTCGGAGCGAGCGAGCTCTCTCGCCGAA
CGGTGACAGGCGCGCCATGGAGAGAGGCGACACCCGGTCGGCAGGGCGTCTCGGGGTGGCAAGCGCGGCTACGGTACCGTGGCGCTCGACTCGGCCTCAC
TATTGCTGGCCCATGTGTAGGGTGGCGTGACCTGCCAGCTGGCATCTGGATGCTCGCCATGCTCCGCGGCCTTTACCTCGACGAACAATGGACGATCGCG
AATTTACACCAAGATGTTGAGTGCAACGTTCTTGAAATATAGCAACACTAGTTCCAGCTACATTCATAAAGTTATTCTTGAGTTGAAATCATATTGGCGG
CAGTCATTTCCGCACAATGATATTGATACTGAGCCACAAGATGGGACCAAGCTGTTCCAATAGAAATCGCTGCGTGAATACGGCCACAGGCTGCGAACTC
CATTGGCCGCAGGATAGTCACGCTGCGTTGGGTTCTTATGCCGGCATCTTGTCCGCAGAACGCTTCCAAGTATACATGCACGGCTTTCCAAACCCGCCGG
CACGCCGCAGCTACGAGCCGCTCAATGCTCGAGGGTCTTCTAGCATGCCGGTAAAGGCCCGTGCGGCTATTGACGCGCAAATGTGGAATCGTCGGTAGTG
ATCCATTCCTTCAGTGCCGTCTCTCTCTTCAACGCTGGCAAAGATGGCGACCGCAAGCAGATTCAGTCCATGCGGGGATGCCACTATGCGGGCTTAGAAA
GAAAAAGAGAGTGGTGTGAAGCCGGATCGAAGCGATTGGAGAGATCCACGCCTAACCATCCAAAGTGGTTGAGCTATCGCTTCTGCCCACTCGCGAGTTG
GCAATCATGTTCAGAACTGACTCAAGCTGCGTGTAGTTTTCCCGTCTGTTCTCAGCAGCAACGCACACCTCTTTGTGAGTCACTGAGCATGTCGTCGCGG
TGTAAGGACTGCCGTCCAGACGGCAGCCTCAAGTCCTTGCAGTGAATGCTCTTCGCATGAAGTGAGTCTTTTACGCTAAAAAAAATAACGGGGACGCCAG
TGACTTGAAGCCGAGCGCTGATCGGCTTCAATATCGCCCTCCTTTTACGAGCTCACCCAGACTGCTGGTCACACAGGGTAGCCAACAGCTCACATCTTCG
TCTGCATGCTCAACGAATTTGCCACTGTGAGCCAAGTTGAGACGTAACAGCGACAGTGTCGGCAATCTTCTCGGATTGAAAAGCTGAATCGAGGTGTTTG
CTTTGAACAAACAGAATCGCTGTAGCTATTTAGTGTCTTTCGCGTCAACACGTTTCGCAATCTTGAGGGAGGCAGTGGTCAACATGTCCTCGTGACATGC
TTGTCTATTGGGTATCCATCCATTGAGTTGGCCTCGTGAATGCAGGTAACTTGGTGTTTATTTCGATAGTCTTGTGGTAAACAAACTGGAACCGGCGATG
ATTACCACAAAAAGAGATGCATTCTCGTCGGGCGAGTCGCTTTCCAAGTTTCCAACGCCACATAAACAAAATTTGTGAGACTACAAGAAGTCCGCAACGA
CGAATGAGCCGGGTGCACACCACCTCAACCAACAACACCAACAGTAACAAGGACATGACGCGCATTGTGATTATCGGAGGTGGATCTGGCGGTTTCCGTC
TGGCTCAAGCTCTCGCCAAGAACCTTACTGAGAAGGACAACACGGATGTCATCGTCCTCGAGAAGAACGCCTTCTTCTACCACGTCGTCGGCGCCCCGCG
TGCCTACGTGGACGCCGACTACACCGACAAGATGTTCATCCCGTACGACAACGCCATCCCCAAGCACTCCGCCAAGTTCGTGCGCATCGTGCGCGGCGTG
GCCACGCGCATCTCGGCCGAGACGAACGAGGTGTCGTACCACGCGATCGGCAGCGACGACCGGCAGAGCGAGGCGACGGAGACGCTGCAGTTCGACTACC
TGGTGCTGGCCACGGGCAGCTCGTACTCGGTGCCGATCAAGCCGGACAGTCGAGAGTTCGCTAGGTCGGCCACGGAGGCCAAGCTGCAGGAGGTGCGCGG
CCACATCGAGAAAGCGAAGAATGTCCTGGTGGTGGGCGGTGGATCTGTTGGCGTCGAGGTGGCGGCGGAGATCAAGGCCAAGTATCCAACCAAGTCCGTG
ACGATCGTCGACGCCAACGACAAGCTCATTGCTGGCAACAATCTGCGCAACAAGTTCTACACGTACCTGAACGAGTCACTAGAGAAGCTGGTGGTGGTTT
TTTTCTTTCCAAATCTGCATCTAATCTCCATCTAGGAAACGAATGCACTCACAAACTTACTTGGGGGGCGTGGCGCCGAGGCTTCCCCAGGTGCGGCCAG
CCATGAAGTCCTTGGCCTTGACCATCCACGTGACCCAGTCGCCGACCACGACTCCGCCCCAGACAGGCAGCTGCGAGACACCTCCGCTACCCACTGGCAG
AATCACCGCCTCGGTCGTGACCTTCGGGTAGGGCTTATTGAAGCCGTCTTGCTTCTTCTGCACGACGGCCGCGAGCTGCGCGGCGAGGAACTTGCCCTGG
TCAGCGGCCCAAAACTCCATCTTGGGCGTCGCGTGGTTGCTGCTGTCGCCCAGCGCGAAAATGTTCGAGTACTTGTCGTCGTCCAGCTGCAGGAGCTCGT
TCACCTTGATCGATCCCTGCTCCGTGACGAGCGATGGATCCATGTCCTGCACGAGATCGGAGACCGGGTGGAAGCCGCCGCACAGCAGCTGGATGTCAGA
CTCGATCTCCGTTCCCTTGTCAGTGCGAAGGGTGCGCTTCTCGAAAGAGTTTCCAGGCAGGCGCTCCGTGAGGCGTTCGCCCAGGATAACATTCACCTTC
ATGGCGTCCAGAGCAGCGTGCAGCTTTGAGTAGAAGTTGTCGGACAGCTTGTTCCTCGAAATGAGCTCGCTGTGGGCCTCCAGGATCGTCACGTCCTTGT
CCGGGTACTTGGCCTTGATCTGGCCAGCCATCTCGCAGCCGTGTAGTGTCTTTCGACCCTTTGCTTGCTTAAGAATCCTTGCTTGGAGGTGAAATGAATT
CTGGTATTCAATGCAGCCGCTGCGGCTTGCGCCGCAGCGGTTTCTGTTAGTTTCTCTTTGCTATATGCCTCCTTACTATGCAGTATACAATTGCTCTGAG
AGTTCGCCCCGCTCTCATGCTTCTTCATGTCGTTGATAACGACCGTGCGAAGTGTCTGCTGAAGGCAGCCTATCCCACTACACCGCCCTCCAAGCAGACC
TTCGTGCAGGAGCTCCCGCCATAGCTTGTGTCGCACTACTTCTTGGTGTTGCGCTTGGCGCGGCGTTGGCGGTGATTCTGTTTTGGCGGCTTCGGTTGAG
CATCATTATCCCCACCACGCTTGCCCCGACGGTGAGACAGAGTTGGCTGGGCTGTAGACTCTGCACGCTTTCTTCCTTGGGGATGCGACCGCAGTTGGAG
AACGAACTGACGTAATTCGTCGTCGTCGGCACTGTCGACATAGTCCTGCAACTTGATCGGAACATCCTCATATATAGTCCTCACAGGCTCCCAGGAATCC
TCGATGGCCTCGAGGTCTTCCCAGCGCACCAACATTTCATAAGTGTGCGCTGCGTGCTTGCGGTGCTGAGTGAATGCCTCCACAGTTAAGTAGATGTCTT
GGTTTGCAATGTGTGCCAGCATTTCCTCGTTGACATCCAGACTTTGGTCCGCATACATTTTCAAAAGCGAGGCATGAGCAAACTGTCGTAGCAGTGATCA
AATGCTCGATTTCAAACGAGTTGACGTTTGCGCCAACACACGGTACGGCCCCACCCACGTGACCGAAAGTTTGTTGCCCTGCTTCTTGGCATCGACTCGA
GACCAGAGAACATAGTCGCCAACATGAAAGTTGACTGAGCGAGCACCTCGCTGTTTGTTCTGGTTGCGCTTAGTTTGCTTTTCCTTGGCCGTGGCTACGT
CTCGGTGCATGCCATCGAGCGACGCTCGCAAGTTGCCAACAGCCTCACGCACGTCTGGCGAGAAATCACCCGTGGTCACCACATTTGCCGCAATAGCATC
ACTGCCAATCAGGATTTTCTGCAGTGGAGTCGTTGCCTTTACTCCAAGAAAGACTTCGGCTGGGGCGTGGTTGGCCAGAGATGCCACTGGGCTGTGATTC
AAATTCGCTTGAATGAGTGGTAGCAGCGCGGCCCAATTATCTTGCTCCACCTTAGAGCCTGTTCGCGTTGTACTAGAGATGGAGATGGTGCTTGATCTCC
ACCTACAGCTCGTTCGCTACGTATCCATACGCACTGCTCCTAGCACTTGAGCATTGGTTTCATCTCTGCTTTCTCTCCTCAAAAGCTATTTTCACCTTGA
ACTTGAAAATATCCATTTCAGTCGAAGTCGCTCACGATTCTGGGGGCGTGCCAAACGCGGCACAATGATGACGAAGTTGCATTGTAGCACCACCACTGCC
GGGGTATCCGGGCGTGGGGGATGCCCCTAAACTTGATGCAATGCGGGCTTCTGCAGCATTTGCGACGCCATCCGCGATGTCAACTGCCCACTTATGCGCG
TGTATCGTTCGACTGCGTCGGACTTCCATCTCCCAAACAGCTTCACTGCCAGACTATCAAAACCAGCATTAAACAGCGCCGTAGCGCCGCCACTTCGAAG
GGAGTGCGAGGCGTAGTCTTGCGGATTATGGCCAGCTCGACCAGCAGCAGCCTTTATCGCTCTTACCACGTCGGATACTTGCAAATTGTGAGATGCATCC
ACCTTGCACAGTAACTCGCCCGCATCAATACGAAGCGCCTCGTGGTGACGAACTAGGTACCATGCTGCTAGTACAGGGCAACACCACCGATGCCCAGATC
TCGCCAATTCTCGAGAAGTACCCTTGCCAAATTGGTCGGATTGACTCCCTCGAAATTGTAGAATCACCGAAGTCACATCATGAAGGTTTCGGGTCTCGTG
GCCTCTAGCATCCACATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCCTTGAGGACGCATATCCGGCCTGCATGCCCTGGCTTTTGCTAAACTG
TCGATGCGCCGTGCGATAACTACCACTGACTCGTATCTCACTTTGGGCACCGACTCGACAATAAATGCAGCGTTTACACAGTCGTCTTTTGGGTAGGATA
AGTCGTGAATTGTGCGCACTTCCTCCATCGGGTCCACATCCTTCTTCTCAACAGCACCGAGCGGACTGCAGATTAGTTCTGGCCACCGCTCAATGATATC
AGCATCAACTATCAAATATTGACCGGAGTCTTGGCCATCCCGAATGCTTCTTGTGACAGCACGTAGGTAACGTCGGCAGGAACCATGGTTCTTCGGTGGT
GGCCGCCGCGGTCTCGGCCGTTGTCTCCACCCCACGTCGATGCCCTTCTCAGCAATTTCAACGAGTAGATCGAAATGTTGATAGCCGTTAAGAACGGTCC
GCAGCCGGACAGGATCGATGGCTTTGTTCGGTCTGCTGTCTACGCTATCTTCACCCCGCACAAATCGCGTAGCCTCTTCCGGGGACATATTGTGCGTGCG
AATTACGGTGGATAGACTTGCAGGCTACTTCGTCAATTGCGTAGACAGGAGATACGAGTCGCTTTGCACTAACGAACCCCCGTTTGCGGTGCAGGACGGA
AATTCGAGCTTCGGCCCGAAGTAAATCCGCTTCCAAACATGATTGAATCTCTCGCGCCGAATCCAATGACAGACTAATGTGGGCGTGACTGCAACACCTC
AACCGACAAACGCATGCACCCTCCACCGGCAACTGCTGCGACCCAAGTGATTTTGAACGCAAGTCAGCTACCCGGGTGCAGGATACCTTGCCGGTCTCGC
TCCTTGCGTCTGCCTCTGTGTCATAACAAGGCCTCGATTGACGACTATCTGTGCAACCAGCAGCCATTGGCGCTGTCGGATTTACCGCAGATCCCGCCGA
CTGCGCACAAATTACCTCGCCAATCTTGCTCGTTGTTGTGGGTACCCTAATTGAGTCGCGTGGGGGCCTCGATTCCACGCGTAATCTAGACTGGTCCAAC
ACCGTCTGAGATCCATCACTTGAATTGATTGTGTTAACGCAGTTTGCTACTTGACCTCGCGCCACCCTATCGGCTTTGCATGGCACCGCCGACGGTCGGT
CGTTTTGCGTTCGTGATGGATACATTGCCAGACCAGTCTGAACGAGTCATAACTCTTTGTGCTCGTCCTTCAGCCCACCAAAGCGCCTGTCAATCTCTTT
TTTCACGATCGCGGGTAGCTGCTTGGGAACGAAATGCCCATGCTCGCTGGGACAACCGCCATCACTGTCCACCGCACAACCCGCCGCTGAGAGAAAACGC
ATGCACAGTCGTCGCGACTTTCCTGATGCGGGGTCGTTCTGTACTGGTAATTTGCGAAGTACTTCCTTAGGGATTCGCCCAAATCGCTTTCTTTCCGTCG
TGGTTGCGGCCGTTGCGGAGCTGGGATCCTTGTTCAACGTGGCCCTCAAGGCGTGCTGGTCCCGACATCATCTCGTGTCGTACATCCTGCACTTGCCGAT
GCACCTTTATAAACATCACATCCTTGAGCAACCGGTCATCGGTCGTACAACATTGCTGTACGGCTCGAAGCTCACCACCTTCCTCAGCCGCTGTACGAAA
ATCCTCGAGAACGTCATTTACCCAGAAAACTAAGCTAGAAATCTCTTTTGGCGTCCACGATACCTGCGATAGCGTGTGTTCGGTGAACTTCACGATGGTC
TCAACCAATTCGACCAGTTCAGCACAGCAAAACTCGCGAGCATAGGTGAGGAAAACCATGGCAGAGTCCACAACATCTTCGATGCGCGATGCCGGTGATG
CCGCCGAGAATTCTGCAGTTGCGGACAAATTGTCAAAGTTTGAACCACCGGCCTCCAACCAAGCCACCCGCTCATCCCTCGATAGTCTTGCAAAGTGTCG
AATCGAAAGACCACCAGAACCGAAACGAATATCATAGGCCCGCGTACAAATTCCAGGTACGGCTTTGAACTCCACGTGCTCGGACCGAACTAAACCTCTG
AAAAACACATTGGCAGACTTACCTTTGTGCTTCTCCGTTGTTATGCGCTCGTGAACTAATTCCTGCTCCTCGGACGGTGCAAATGCGTACTTAGACGACT
TCTTTCCCCTTGTCGTAGGGGATGGCTTCTGTATGGTACCACCACCCTCCGCCGGCTGCGCTTTGACGTTGGCCTCCTTCCTAATCATCAAGAAACGCTC
GAGAAGGTCCGGTTCGTCGCTTATTTTTGCGATAATCAACGCGTCTTGATCAATAGCGGTTTGAACTCGTTGTCGCTTGGAGGGGACGTGGCCATCGTCG
CCGTTGGCAACCGTGACCTCTTGCTGTCGTTTTGTCACGTATTGTGTGGTAGTGTTTGCCCGACCAACTTCAGCACCGCGTTCCGATTCGTCTTGGGGCG
AGTCATCGTCGTCTGGAAACGGGTCAAAGAGCTCTTCCACGTCCTGAACCGAGCCGCGAGACAAAGCGGACGTGCTCCGAAGCGGTTGGGGCGTTGGTGG
TTTACAAAATGAGTTGCCTACGCTGCGTGGCACTGGTGACACCCCTCCGTCGACGTAAAAAGCGAAATTTATAGCGTGGGTCGATCCACTGACACACCTT
GTCACCACTAGGGTGATTTTCCTCACTCATCAGACCTTCCAGTATCTCGGACACTTGATTTGAAGCAGAACTACCGCCGGTACCGAGAAGCCGACTCAGA
ATTGACTGCTCCATCGCCTCTAGGTCAGTAGGACTCCACTCGTCGCTTCTGAACTCGACGTCTTCAAGCAACAGAACAATCACTGGTGGCACCACTGACA
CTGCAGCTGCCGCTGCCACAAATTCATGACCACCGGATCGGATCGTGACACTGCTCTGGTCGACCGAGGTCACTTGTCCATACTGAACCTCTCCAGCTAA
ACTGATGGACACGGGTCGTCGGAGCAACGAGATCTGACCGGCCTGGGAAACTTCACTGGCCCGAACCACGTGATCTTCGGCGACGGCACGATCCAGTTTC
CCTTCGCCTCCTTCCAAGCTGCGAAACGTCACCTCCTCCGAGTCTAGCTGTAAGACCTTAGCATAAAACGGATGCTCTGCTTCGAACTCCACCACTTCAG
TTGTCAGGTGAAGGAAGGAGCGGCTTGTAAGTCTCACCATGACCGGAGTGCTGAAGGCTGAAAGCTAAAGCAGGAGGGCTTAAGCGGCAGACGGAGATTC
TGAAACTAACGCTACGACCTCTACGACTGCTCCTAGCACTTGAGCGTTGGTTTCATCTCTGCTTTCTCTCCTCAAAAGCTATTTTCACCTTGAACTTGAA
AATATCCATTTCGTCTCCATCTCCAGCTACGTAGCGAACAGGCTCTTATACTCCAACAGCATGACTCGCAATACCTGCAGAATATCGCGATTTAGTCTCT
CGACGCTCCCATTGATCCACGGGCAATACGCGAGAGTGAAGCTCTGAATCATCTGGGTTTTGTGGCACAATTGCTCCAGTAGTTGGTTCTTAAAGTGCGT
TGCAGTATCGCTGATCAGCAACTGAGGTATGCCGTATCGACTATTCCAGTCCAGAATTGCCGTGGCCGCTGTGGCCGCATTTGCACTCGAGCACTCGATC
AGTTCGCAGTAGTGAGAAAAGTCATCTTTCATGACCAGCAGATAGTTGCTCTCTCCATTGTAGTCCCCAATGAACAAGTAGTCCATGTGCAATGCTTCGT
TGCGCTCTTTGGAACGATAGGTCTCACCCCACGGACGTGGTATTATTTTCCCGCCCTTGACGTGGCAGCACAAGAGACAGCGACTGCAGAATGCTCGTGC
TTTAGGCTCCATTCTTTCAATGAGGAAGTGTTCTTGGAGGTGGTTGATCATCACCTTCACCCCTCGATGACCCATTGTGCCACAGTGGGCGATCACCATC
AGCCTCATCAAGAGCACTTCCGCGTCCTCCGGAATCCACACACGGTTTTGCTTATCTCTCCACAACCCATCCGGTTGCTCCTCGAGATGCGGCGGACGAG
TGCACGTTGTTGCTAGTTGCGCACCTTTGATGTCTTCCTCCGTAGGCCAATCAGAGTCTGGACGCAGTGGACGAAGCTCCACCTGCACATGTGCATCCTG
CGTCTGCCAACGCTTGATCGTTGTAGTCTCCCTGGGCAACTCGATGCAACCCCAACGAGACGCCATATCCGCCCACACATTTTCTTCTCCACTGATATGT
TCAATAGTATAGCGGAGTTCATTAAGTTTCAAGCTCCATCGCTGCAATTTCCCTCGCACGTGCTTCTTGATCTCATCACCCGGTGCGAAGATGAAAATCA
AGTTGCGATGATCAGAATATAAGCGGAAACCTTTAGAGCGGATCAGCAAATAGTCCAAGTCCGTCGCTGCCTTTATGATCGGAAAGGCCTCTTTTTCCGA
TACACTCCAGTGCTGCGCAGCTCCCTTGAACGTGCCGCTCATGCAGTGCACGAGTTGATGCTGCTACTCGGTAATGCTAGTCGCAGGATCCCAGTCCGCG
ACAGCCGTCACGATGATGCTCCAACCTGCATCGCTGGCGTCCGTCATCAATATGAGCTCGTCCGAGTCATCCAGAGTCACCAACGTAGCGAGTAGTTGCT
TAACTTGGCCGAAACTGATGCGTTCTTCGTCAGAAAAATTAATCGCGACGCGCGCTGCAACATGCTTTGTCCGCTTTGTTCCTTCTAACGCAGTCTGCAG
ACGTTCTTGCAGTGGCGCAGCTACTCGAGCGAAATCAACCAGGGAATTGCGCATCCAGCCGGCCGCACACAGAAATTGCTGCAACTCAGCCGCGGTTTTC
GGCTCAGGAAGATCAATCAGCGTCTGAATCTTTTCGTGATCATACGCGACCCCGTCCTCCTTAATGATTCGGCCGCATCACTTTGCTTCGGTAGTGTACA
GGCAGACTTTATTCAGCCCGAGAAATAGTCCATTCTTCTCCAAAGTACTGTAAACACGGTCAAGAATCGATAAAATTCGTCTATCGTGTGCGTAGATGAG
AAGGTCATCAATCCAGGCCAGTACATGCTCGTACAACAGATTCGCTTCACGCATAATCTTCTCAATCGATTGCTGAAAGTGGATCGACGAGTCCACTGAA
CCTTGTTGCAGACGCGTTGGCGTGAAAACACCATCTTCCGTCATGTAAGACTGTGACTCTTGACTTACTTTAGCGAGAGCCATTTGCCAAAAGCTTTTCA
GGAAATCGACAGTTTGCCGGTGTTTCTTGTTCTTCGTGTGGTGAAGTCGTGTACTGAGACTGGGCATGGATCCGGCTACAGGTAAAACCTGCGCATTAGG
ACGACGAAAGTCCACAGCTTGACGAAGTCCTCCCGTTTTTCCTGGCTTCTTCACAGGTCGAGCAGGACTCGCCCATCAGCTAGCTTCATTCCGATACACC
CAACCGAGCTCAACCAGCGATTCGTTGAGCGCCTTCATCCACTCGCGCTCCGCGGGTGCGTAGGTGCGTGGCCTGCACCGTATTGGCAGAGTTCCCTCTT
TGAACCGAATGACGAACGGTTCAATCTTCGAAGGTGGGTCATTTCCAATCGCGATGCGCCAGATATCGTACCGCATGACAACATCAAACAGTTCTCTTTT
CCGCTCTGCAGGGAAACCATTTGCAACAGCTTCGTTGATAAGCTCACAGAGTCGTGCAATAACCTTCTTCTTGTCTGGAGGATCAAAACTCATCGGAGTT
TCTGACTCGAACGGATCAAAATCCACAATCTCCTTATTCGCAAGTGCAGAAAGCTGACCTTCAACATCAATTCCTAGAGTCTTCAGAGTGAGCCGGCCCA
ACAGGAACTCATCCTCTTCTGTCTCCGTGATGATACAAGTCACCTTGCGCATGAGAACCTTTCCTGCAGGCGTGATCAACTCCAAATCCAGCTGAATCGA
TTCATCACAGCTAATAATTGCGCCTCCCACAGCTTTTCCATCAATCGGCTTCTGTAGGCGCTCAACTTTCACATCCGGACAGGCTTGCAGTAATTCCTCC
ACAATTCAACGAGGAATCACATTGTATTTCGTACCATTGTCTCGGAAATAGGGCATTGTTACCACCCCATTGAATACAACGTGCATTGGTGCGCGGTCTT
CACCATCTCCCAACACTCGCTTCATTTTCGACGCTTCAGCGCCCTTGCGTCGATCCATGCGCTCTTTGAACGCTTGTCGAGCAGCCTTTTTTTGCTCATC
AGTGGCCGAAGGACAGTCACTGACCTGTGGAGTAGCGCCGTCGCAGAAATCTCGCGAATGCGATCTCGCACAAACTCGGCGCGTCTGGATAGCGGTCGCG
CCGAGCGAATTATTCCCGGTTGTTGGAGTAGCGTATCTTCGAAATACAGGCCCAAGTCTTCGCAGGCTTCAGAGTTGGGGGGGGGTTCTTGTGTTGACGC
TTGTTCCTTGTCTTAGGGCGTCGGGCCTTGGGCGTGCGGCGTTATCGGGCCGGCGTTTCCTCGGCGTTCCCGTCGGGCGCGCGGCGTTATCAGGCCGGCG
TTTTCTGGGGTGTGTGTGGCGTTATCGGGCCTACACGGGGGGTCTTGTGCACGGCGGTTATCAGGCCAGTGCGGTCCTTCGCCTAGGCAGCGCGTTATCG
GGCGCCCACCTAAACGGTATACGTTTAACGTGCCTTTGATCCAGCACGGGTCTGTGGGGGGGGGGGGTGAGCACCCGAACCAGCAAACGACGGGGGGCCG
CGATATCGAGGCGGCTCTACTTGCCGGCGCTTGGTGGTTCCCCTGGAACCTCGGAGAAGACAGGAGGTCTTTGTGGTTCAGAGAAATTTCGGGACTGAGT
CCTTACCCTATCCTATGCCCTAGCTACTGGCTACTCCGTACTACTGCTTGCTAAGCCTATCGTTCTGTGCCTATCCCTACTTCTGTCGTGCTTGCACTGC
CGTCCTTCAACCTGATTTGCGTGGCGCAATCAAGATCTTACCTCGGCGCGTTTTGCTCGGCGGGGTTTAGGGTCGGCGCGTTTTGCAGAACCGGGTGCGC
TGGTCGACCCGTCGGATGATTACACGTCGCACTGGATTCTGACACCGTGTCTCACGGCCCATCACCCACGCCGACTTTCCCGTCGAGCTTGGCCCTGCGT
CGCGCCCATCAATCCGCGTCGCGTTCCATCAGCCGCGTCGAAGTCCATCACTCGCGTCCCGGCGCCTTCTTCCTCCGGCGCCCGGCGCGCCCACTTCTTC
CGCGGGGTACTACACCACATCCGTCCCGCTGCCACGCACGCGCACTCCCCAGGTGGGTGTGTCGTCGCAGAACCTGCCCCGCGCCTTCGCTTCGTCTCGA
CACATCGCGTTTTCTGCCCTCGCAGTCCGCTTCGCGGTACTCCAAGCACGACGTCGACATCAACGACATCGACCTGGAGGAAGAAGAGCTTGACACCGAC
GATCTCGAGGCCGCTGGCTGCGCGGTTTGTGCCCTCGGCGCGCATCGTCCTCGCCTCCCCGTCGCGCCCCAAGTCCAGCTCCCGGCTTCAGGCGCCCCCG
TCCACTCGGTGACTGCTCTTGTCGCCGACGCGCACACTCTCCCGCGCGAGAACCAGGAGCTGCGCGCCCAGTACGAACTCGTCTCAGCGCACAATGCGGG
CTTGGCTACTCACGCGTCCGTGCTGCATGACCGCAATCTCGCGATCTTGCATCGTGCTCGCGAGGGTTATCGCGCAGGCATGATCCGGCTCGAGCAGGCG
CTCCTCTCCCGGGAGCACGCCGAGCGGGACTACGCCGTCCTGGAGGACCGAGTGACCGACTTCCGCGCTCGTGCTGAGCGCGCCGACGCTGCCGAGGCTC
TACTCCGCGCCGAGCGAGGCTCCTCGACAGAGCAATATCGTGATCTTCAAGCTCAGCTCCGGGCGGCACGAAACCAGGTCACTGACTTGACTACCGTGTC
GCTTGCGCGGCTGTTTGCTGCACAAGGCGGGCGCGACGACGCGCGCGCCGAGCGTGACGACCTTCGCGTCGACCTCGCAGCCGCCCAAACCGCCCTCGCT
CCTGTCCAAGCGCGCGTGGCCGCCGCCGAAGCTGAACGAGATCACATGCGGCAGCTCGTGGCCACTGCCAAGCAGCAGCGCGACGCCGCTCTCGCCGAGC
GTGACCGCGTGACCCGCGTTCTCATGGTCGTCGAGCAAAAGCGTGACGAGGCCCTCGACATGCGAGATCAAGTGCGTCGCGCCTCCACGGCCCTGAGACG
CTGCTGTCACCGAGAGGGACCGGGCACGTCAAGCCGTGGCCGCCCTTGAGCAGCGGCGAGACGCTGCCGTCGCCGAGAGATCAGGCTCGTCAGGCCTTGA
CCGCTCTGGAGCAGCAGCGCGCCCCTGTCGACGAAGAGCTCCGCGCGGCCCGTGCGTCGCTTTCTCAGAGCCGCATGGAGATCGAGGCGGCCCAGAACCT
GAACGTCCCGCTGCAGGACGACCTTCTGCGCGTCAA