Description :
From Genome Similarity Track
Location :
Scaffold_9:168069- 170762
Sequence
2693 bases(100 bases per row)
ACTATGCGCGGCGTAACCCACCTATAGTACGTTTAACGAGCATAGCAAACCCACATTGTTTGCATATGAGATCGCCCATTTTTGTCTATAGCAGGGTCTT
GTACAAGCGAATTGGAAGAAAAGATGAACAATAGTACGGCGCGCAGGTTGTTAAGAGATGTATTACTAACATCAGATACTGCGACTGCTGCTTCTCTTGA
TTACTCACGCTTGCCATCAAGTGAATGGAAATGTTAGGTTTGTGGAGGGATAATGCGAGATAACGATGATAGAAAACGGTCGAGATTGTGTAGTGGGTCA
ATTTAGCTCCGGATACATCAGAATTCGATGCTTATTAATGAAAGTGAAAATAGAAAAATACCCCACGTCCTAGTATACTCAAGTTAACTACACATATACC
GACATGGTGCTTTGATGAAGGACTTAGCCTATAATAATCACCATTATCATGCAATGTATGGATACGTCTGACTTTCATTAGCTCTTAAACTGTCCGCGTC
CAGCGTGCTGTCCATGAAGTTTAAAATAATTAACAGCACCAACTAATCCCTGCAACAGCACTGAATTGTCGCCATAAGCACTGTTAAAGCCTTCAAATTA
GTAAAATGAGAGTCAAACAGATAGAATGAATTGATGATTGTCTAATTAATGATTAAATATGTTTAAGTTACTATAGAGTACTATCAGGCAGTGAATTCCT
ATCCAACAAATACAACAACTATTATAGGAGCACTGTGGCACCAAAAAACACCACAAAACAGTATTAACACCACGAACACTAAACGCAGTAGCAAGAGCAG
TAGTAGCAAAAGAGGCGGTAGCAGCACTAGAAAAGGGAGCAGTATCAGCAGCAAAAACAACAGTTGTGTGGTGGAGTGACGATCGCTCATTTTATGAGAC
GATCCCAACTATCCACTGGTGCCCAGACGACCGACTATTGGAAGAGGGTACTCAGTTTTCGTGCCTGGTATTTTCTCTCTCAACTTGTCTACCCGTCAAA
AGGGCGGGCTGCACTCTTCTCGGTGGACTTGTGTCGAGGGAAAAATTGACCGTGTTGGGGATGGGGTTGGTGATCGTGCGAAAATCTTCACACGATCACG
GGTATACTGGTAGGCTACTTGATGTAAGCCACCCAGATCTCAACGAGATCGCCTTGTCCACTATGTGGATGCTTGATACGCGAGCCTTCTTATCACTTGA
GCCGTCTCACGATCTCGCGCCTATCCTTTACGTTCTTGCTGCGTCCGATATCAGTTTGGGGAGGTAAAAAATTCGTGATCCCAGCCAATTATCTGGGGAT
ATCACTTGATTTCAGTATGCGCGACTTTTTGACATACGAAGGCCAATATTCCAGCCTGGAAGAGAAGTCGACACGTGTACTCGTCGATCCCCTTGATCAA
ACGTCAATCTCCCTGATCATCGATCACCCTGATCGATCGTTGATCACCTTGATCGATGATCACCTTGATTATTCGTCGATCACCTTGATCGCCCGTCGAT
CACCTTCGATCTCCGATCATATTCGGAACCTCAATCACCCTAAATATTCTCCGTCCTGGTATCTTCATAATCGATCTTGCTATCTTGACAATTGATCTTG
GTATCTTTATATTAGATCTCAATATTGTGCAGCTTAACAGCCAATCGATCCTTTTCGACGATCAGTCGTCGTTTTCGACCAATCAACCCATCGATCACTT
CAAATTTCTTCAAATTTCTTCAAATCGCTTCACCACAGCTACACTAGTTTCAACAACAAGAGCAACAGCAGCAACGACAGCAACAATAAAATGACATCAG
CACCACCACCACCACCAGCAGTAATAAAGGCAACAGGAACATCATAAATAACTTACAACGACAACGGGTACAGCAGCAGCGGTAGCAGCAACAACGGCAC
TAGCAAGCAGCTGAAACAAAAATAACAATAATACCAAATACAACATTATAACACAATAACAACAATAATTAAAAATGATAAGAAGATAATAATCAATGAT
AACGACGTCAGCACGGGTTGTCTACATTTACAACCACGGTTAACGATACAAAGACGCGTTAACATCTTTTCTGTGCCGTTTGCGCTCACAAATGGTGGTT
GGGAGCGCAGCACGACCGCAGCAGAACCTTTTACGCGGCTCCGCCTTCAGGGCGGGGGTTAAAGACGGCCCTTACAAAAATTGTGAAGTGATGACCGATG
TAAATTTTTATGTGTAGCACATTAACAAGCGTATACGAGGATAGGGGGTATTTTTAGGAATTCGTTATTCACCCCCCACCTTTTTGTTAACCAGCCCACC
CCCTCAAATTAGAGCCTCTGATTGGTCAGCGGGCAAATCAAAACTTTAATAATCAACACTTTCAGGACAACCACCTTGCATCCATCTTCCTTTTTTCAAA
AAAAGAACCCCTCTCTCCAGTCGAGTTCGAGGCGCTCGTCAAACGTATCCTCCATGGTACCCCCCCTTATCACAGGTTGGTAGATCGCAAGTCATCATGG
GCAACAGCGACAGCAAGAGCAAGTTCCGCGAGAGTGTGTACAAGCTCATCAACGAAGTCATCAGATCGAAGAACCTCGAGTTCTTGGACAAACGCTGGCG
CATTCCCACGGTCGCGGAACATATTTACACGCTCATTCAGCACGACGACGTGCGCATATTGCGCCATTATCAGCTAACGAACTTGGCCACGAT