Description :
From Genome Similarity Track
Location :
Scaffold_23:168042- 191253
Transcript NameFunction/comments
g7261.t1hypothetical protein
g7262.t1hypothetical protein
g7263.t1hypothetical protein

Sequence
23211 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACAGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGGTTAGTTCTCGTCAGC
AACTTAAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGTCCGTCACATGATAAATTTGAGGCAGGTTCCCACGTGGGT
TCGTCATACCCAATCCACTTCACCTTGAACTCTCGGACAGCACGGCTAGTGCTCGTCGACAACGGGGATCGGTCATCGAGGATGGCTTCAACTTCATATT
CGCCAGCAAGCTGGTCCGGCTCCCAGCTATCTTCAGGCAACAACTCCTCATCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTT
CGGTCGGTCTCCGAATTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCACTTCCAACTCGTACGCA
AACTCTTCAATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGGGCCAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTC
TGCTTCCAGGTTGGAACAGAGATCTCGGTCCTTCGACAGTGGGGTCAGACGTTGCCCCCGTCTCCACCTGTAACTCGTCAGAGGTCTCGTTTTTATCGAC
ATTCGGTACTGCAGCACTCTCGCGCCGCTCCAGCGACTCATTATGTTCTCTCACCCTCCGAGCCTTCTCGACACTTTGGTACTCCATTGCCATTCTCCAC
GAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAGTGCGTCAGTCTGGCCTCCGAATCCTCATTTGAGTGACGATGACATCGCTCGCAGCGTGG
ATTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTC
CCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGGCCTCTCTTGCTGTCCGTTCGCCTCCGGCCGATAGCTC
AGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATTAGAGTTGGTGCTC
CGAATCTTCGGTACACGCTTTCCTCGAAAGCCTGTGCGACCTTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTAAACGCGCACTG
GAACAGTAATAAAGCTGAATTGCTTCGACGAGACTTCAGGGATGGTATGACAAAATCCATCGACACCATCTGGAACAGTCGCTCTGCCAAGACGCTTCCT
GGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCGATCCAAAAAT
AGTCTGCTTTGACTCGGTGGTAGGTTCGACCGATACCTTGGTGACCATCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGG
CACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACAGTTCGTTCCAAGAAAATACAGTACCCTATCCTCGCTAAGTACGAACTTG
TCGGCCATCTTCCAAGCATCTCTGGCTGCTCTGTAGCTTAGGTCTGTTTCCTCACCGCTTTTAGGTTCGACCATCTCAGTTCTTCGTCCTGGGCGGCGGA
GATTCGTCGCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTACGTTCGGAGCGCCAGGGTCCGCCTCGTTGCTCGATTGCTCGGCTCTCAGC
TCGTTCTGAGCTTCGGTGATCACACCATTCGCTTCGTCTCGTTCAGCAGCATCATTCGGCCCTATCACCGAAGTTTCATCTGCAAACCGGACTCGTTTCT
TCCTTGTTTTTGCTTGGTGTCTGGTTGTTGCAGCTAGGTAGTCTGGTTCGTCCCACACAAAGTCGAAAACAAATTTGTCACGGGAGATTCCATGGGCTAC
TTGGGCTCGGGCGAAGCTGACTGCCGGTTCCTCTTCGGCTGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTCT
AATTTCCTAGCCTCGGTCGAAGCTATGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCCGCAGCGTTGAATTCTCGGACCACATGGA
AATACTTCACTGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGTACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGAACGGATG
AACTGCGAGACTCGATTCTCCAACGATGACCAAATTCTCGGCTCCATGTTCGAGCGCAGCCGAGATGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTT
ACCGTGGTAGTCTCGAGATAAGCACTCGCAGCCGTCACTACCGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCGTATCCACCGTTCTTTT
CGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGGGGGGGGGGTCCATACGAGCAGT
AGGTGACCCTGTCGTCGGCGGTGTAACCGGGGCTAACGAGTCTTCCAATTCTACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTGCAATCA
CGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGA
GCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGG
GTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCAC
TCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTACCTCCGCAACCTTCTGTTGGAGCGCCGCGAAGCTTCGTT
TGGTCGCCGAGAGGTTGCCACTAGGTGTGAAGTCTTCGTCCTTCAACTGATACAAAGCTGCTCCATACACTGCGACGTCTTGGATGAACCGACTGTAGTA
ATTCAGCGCACCAAGGAAAGACTGCATCCCCTTTTCGAAGCAGGGAATGGCAGCTCGGTCACTGCGTTCATATTCTTGGTATCGGCCCGAATACCTTCTG
CAGAGAATTCGTGTGACAGGAAAGCCACCTTCGGCTGGACAAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTCG
GTCTAGCGTCTCTAGGCACGCGTCGAAAGTCTCAGACCCAAAACAGATATCATCGACAAACGACCACCGGTCGAACACTGGCACCAACGAGGATTCATCC
GGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACTGATTCACTGCCTCAAGCGTGACCGAGGACTCTCGGTCGGCCTCGAATTTGGTCG
GCCGAGTTGTTGAATCCTCGGGTTGTCGCAATGAAGGGTCGGTCACCCCTGTCCGTGCATCCTCGGCGTGGGTTTCGGCCGTTCGCATAAGTTCCGAAAA
GTGGAGCCAGCCGCCTTTGGGTTGGACAAATCCCCACAGAGCATTGATCATTCGTTGGTAAATCATCGGTGCGTTCTTCAATCCAAACGGCATACGAAGC
CATTCGAAGTGTCCGAGCGCACAGACGAAGGCTGAGACCTTGCTGGCTCGCATCGCCATCATAATGGCCCAGAAGCCACTGGCCGCATCAAGCGAGCAGA
ACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCATCAACCAACGGCATGGCGTACTCCATAATCGCCGTAACTGCATTTACCAGCTTGTAGTCGATGCA
CAATCGAATATCAACTCCATTCTTCTTGAGCACAATCATGATGGGCGACGCCCATGGGCTGCCCGAAAACGCCACTAGGCGATCCTTCAGCAAGCCTTTC
AGAAGCTCGTACAGCTTCCGAAGGTGTCAGAGCGGTGTTCTCCGAGCTCTCTGTTTATTGGGTGGATGCCCCTGCACGTCTATATCGCACACTACACCGT
ACGCTGGTGGTGGCAGAGCATTCCTGCTCGGAATCATGATCTTCTTGTGTCGTTTCAGTACCGCAGCGAGACTTTCTTGTTGACGGGCAGTCGCGCTCGG
GTTCTGAACATTCAGTCCTGAATAATCCAGGACCGTTCTCGAGGCTTCGGTCAGGTCCGGTAGAAGCGCCAACTAGTGCGCATAGTCCGTCAACTCGATC
TCATTCGCCAAATGTTCGGACGCATTGGTATCGGTGTTCTCACCACCTGAACCGTCCCCCGTGGTAATCTCATGCATCACGGCCACAAAGGCAGAGTCCA
ATCGGGTCTCCGGGCCATCACCGAGGACTGGTGTGGATTCTTCTTTATGGTATACGCACCATCAGAGGTGTCGGTAGCCAACCGAGTCGTCGTCCTCGCC
GACCCAACTACCCCCAACGGGTTAGTCAGAGGATCGCATCGTAGTCGTCAACGGCATTCGGCCTCGTTCCGTCGGTTCCTCAGCACTCCTATCTGCGAAC
TTTATCTGGCCCTCGTCTCGGCCTCCCAAGTCGTCGGATGGTCGAGGTAGGATGCCACGAGGTGTCGGATAGTCTCGTTGTTCTACAGCTGGTGGCTGAT
CTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGA
GTTCAAACGAGTGTATCCATCTCCTTGCGGCAGGTCCCCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAATCCTCGGTGACACG
TTTGTTAGTCTCACCATCGTCAGCTGCCCCCGTCGAGACCTCGTTACAGTGGGCACCAAGCTTCCAATCCGGCGGTCCCAAACGTCATGAGTAGTCAGAG
GCGGCCGTCGTCGTGGTAACCTAAAATCTCGCCACTCACGCCCAGGGACCGACAAGTCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTAGGGCTCGGC
CTCTGCTGGGTTCTGCGACTTCACCAAGGGCACCATTACCTCGTCCGGTAATCTCGCAGTGCCGTGGAACAGATCCAGCCGGACTCCGGCAGGAATCATG
AAGTCCGTTCCCAAGACCACATCAACTCCTGCGCTGTGATCCATAATCCATACCTCAAATTCGTACACGCGTTCCCAGCCCAGGGTGACTTTGACGAGTG
TTCGTCTGCGGGTTTCCATCACCCCTGTGTTAATTCCCCGCACTTCCAGACTCCTACCGTGGTCCTGAACTTCGAGCAAGAACAACCGTTTCGCATATGA
CGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGTAGAATCCTCGTTCGTGAGTCGTTTACGGCCCCATTGACGAGGGCTCGCAATCGCTTTCTCTTG
TCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGGCCTTGCTGA
GGATCGAAGCTTCGGTTGACTCCACTTCGACTCCGTCCGTACGTCGCCAATTCAGTTCACTCTCACCGAGGCTGAAGCCTCTCTCCTTTACATTTTCCGT
CGTTTTCACATTTTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGTGGC
AGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCAAGAGGTCCTTCTTCTC
GACCTCAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTAAAGCAGTAGTGA
GCCGAATGGGTGAGTCCTCCGCAGACGGCGCATGGGCCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACGGGC
GTTGGTCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAGCAGCCACGTGGCC
TCGGTCCTCGGTCGACGCGTATCCATCGTCCGAGTACGCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTCCTCGGTGTCATCA
TATCCGCCGTTGTATGCGTTTGGATATTCTCCACGCGCGTCCGCCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCGTCAGTGAGAGTGA
CCCTTGGTCGATACTGTTGGTCATCCCGGCGACGATTATCGTCTCGGTAACGGTCTTCTCGATGACGGTCGTCGTCTCGGTGACGTCGGTCTCGGCGATA
GCCGTCCCGCGGATCTTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCAGATGTTCGCTCC
CTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGGTCTTCGCACGAAT
CCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAACCGTTAAGTCGGTTGAGGTAGTCGCA
CACATGTTCCTTCTCCTCTCGCTTGGCCAAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGCACAGTAGTACTTGATGAACGCATCGCTCAACAAT
TTCCACGTGCGCCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCACAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCTTTCGTTGGGCGGCG
TGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGATGTTTCCGAGTGG
GAGATGCGTGGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACCGCGCTCAACTCACGAATTTGGCGCGCCCACTCTCCCGTCAAGTCACCCCCG
ACGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCATCGCGGAGGTCGTAACGTCGGCTGCGCGTCCGACTTGCGCTTCGTCCAGCAGTCGGAGCGG
TTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTCTTGGAAATACGTCGACGTCGCACCTTG
GGCCGAACATATTCCGGCCTCGGTCGACTCCCTGGGGCGTCTCCCAGGGGTCGAGGGCAATGGAATCATGGACGGGTCGACCGGATCCGATGCGTGGCGG
ACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGTCCTCGGGTGCCC
ATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCGGCCGAGTATTCCACGC
CTCCACGGGCACAGTCAATTCTCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTCTTCACCTTCATG
AGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCTATTCGGCCGAGAATTCGCATCCTCGGCCATCG
CCGACGATCGGTGATCGTCGGACCCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAGCGA
CCTCACTCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATTGCTGCCTTCTCTTCCAGGTCATCTTCTTTGTCATCTTCCTTG
GCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCGGAACGCCCCGAAC
CCTCGGTACGCGTTCCACTTGACCTCACCGGCGTTGCTGGTACCACTGACTTCGCTTCTTTCGCCATCTTCTCTCTTCTTCTCTTCTTTCTTCTCTCGAA
TGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCAGAAAAT
CTCACTACCGAACGGTATCAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCCTT
ACACCGGGTTGGTTGCAAGCACCTCTGTATACCAAGGTTGAGTTCGGTCAACCATAAAACCTGCACTACGAGCTACGAGCGAGGGCTAGAATGCAATATT
GCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGGAAGGGTACTGGCAGTCACGCCTGATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAATA
CACTTGGGAACACTCGGGTCCCACCAATATATAGGGACCGACTCTACCCGTCGTCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAACACA
CTCTCGGTTCAATGGACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACT
TGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTTACCTACAGCTCTGAGAGCCTCTGTAGGTCATCATTTAGCTAGTCCTATATCTCT
ATACAAATATCAAGTGTAAACAGATCTCTATGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACGAAATAGGTACAAACGAGGCTTTTAA
CCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGCGAAATGAGACCAGCACTCTGTCGGCGTTCA
CTGAAAGGTGCAACGTCCGCCGGACCTTGACAGTTCGGCTCCAAAACCCAACGCCACACATACCGTACGTGCAAACGGTGTCATTCGGATTTACTGTCTT
CACATTTGGGGCTCACGAAGACCTTGGAGAAAGTGCATCGGCACGCGGCCAGGATGGCGGCAGGACGTTGGCGAGTATATATGAGAGTGCAACAAGTGTG
GAAGCGGTAAAGAACACCGTCCCTGGAACGCTGGGCTAATGCAACAGACGCCTGTCGTCGACTTGACCGGTCCCTTTTCGTTAGTGATAGTGGATGCTAT
TGGTCCTCTCCCGGAGACGGACCGGGGCAATAAATATATCCTGGTGTTCGTGGGTTACTTTACTAGATGGGTAGTGGCGTTCGCTTTCAACCGTCTAGAC
TCGGTGACGTTCGTCGAAAATATGGTGAATGGAGTGGTCTCGCGGCACGGTGTGCCTGCTCGGTTGTTAAGTGACAATGGGTCAAACTTCACGTCGGAGG
TGGCGAAGTCTTTTTATCAGACTCTTGGAATCAAGAAATGGTACGGTGCTGCGTACCATCCTTAGACCCAGGGCCTGGTGGAACAATTCAATGGCACGCT
TATCGGGATGCTGAAGATGCATGTGAGCGAAGCTCAGACGGATTGGGATGTATATTTGCGTAGAGTATTGTTCGCCTACTGGACGGCTTACGATGAAGCG
CTGGGTGACTCCCCCATTTTCTCTGTACGGTCGAAATCCGGTGTTGCCGCTGGACGTTGCGTTTTTGAATCTCGGGAAGAAATGGAGAAGTAATGAGGTG
GCACGGTATCGTCGGGAACTGAAGTGCTCTCTGAAGGACTCACGATAAAAGGTAGAGCGTCAATTGGTGAAAGCACAGGATCATCACGAACGATGACTGC
GAGGACAAGTCGAGGTGAGATATGCGGAGGGTGACCAGGTTTGGGTGTACCAGCCGTTCCGAGTCAAGTGAAAGGGAGTACGAACGAAGAAGCTAGCGTT
CTCCTGGCACGGTCCGTGCTGTGTTGTACCCAAAGTCGGGGAGAACGTGTACCGGATCGATATTCCGACGCACCATGCTTAAGTGGTTCCTATCTATGTC
AACCGGTTGAAGGAAATCCGTGGAAGGTGGACTCGCCCCTATACTGATGATGTGCCTGAGGGGATAGAAGAAAATGAGGAAGCTGAGGATGGTCCGCTTG
AGGAGTCGGACTTGCCACCGTCCAGCTTCACTGAAAGCCTGACGGTTGGGCAAGGGGGCACAGTAATTGTAGAATAGGATTCTCCTTTGCTAGAAGTTGT
GGCAAAGCGGACGGTAGATTTTACCGTCGAGTATCTGGCTCTGACTGGGAATTATGAAACGTTTTGTTTGTCGCGGGTGGCACTTATGCCCGAATATGTG
GAACTGGTCACTGCTTTTGAGAAAGCAGAGAGGGCCAAAGGACGGTTGACTGCGTTGTGTCGAAGTGCTCGCTTGGCGGATGCCAATGCGGAAGTCGACG
ACGCAGACTTATTGATGATGCGACCTTCGTTACTCTTCCTTGAGAATTATGAGACGGTTATGGAGTTATGGATTTGGAACTCAAGGAGAAAACGGAGATA
AATTGCATGTTCTATTTTTAAATTTTAGCACCAGACTGGGGATGTTTCTTACTGAATCAAAGGCAAACGAGAAGAATATGGAACGGAACCCTGCAACGTC
TCAGTCGTGGTCTACATTTGCCTGGTAAGTGCGCGGGACGCGTACAGTCACTTGGACGAAGAGGTGGGTGCGCCGGTCTTCAGGGGACTGGAAGGCGTCG
GCGAAGAATTCTTTTTCCCGCTTCTGCCGGACTTGGGGGTGCCGGACGACTCGCCGTTCTTGTCGTTTGCTTCCTCGTCGTCGGCTTGGTCACCTGACTC
CTATGAATCCGGCGACTCGTTGATGCGCTGGCTCGCACTCTTCGACTAGACCGGAGGCGTCGGCGGCAACACCATGAACTCTTCATCCTCGTCCTCAAAG
TCTGAGCCATCATCGCCTTTCTCGCTGGGCTTGTACGGCTTCAAGTCTTCGACCCAGATTTTGACTCCAGCGAGGATTGGCTTGGCCACATCGGCCTGCG
TAGCGCGAAGCGTGCAGTCGGACAAGAGCTTCTTCCAGGACCCGCTGGGCCGATTGCCGACCTAATAAGGCACGGGAGGGTCGCCACCGGCGACATCCAA
CGCGTTGCGGGCGAGGGCCTTGTCTGAAAGTCGCAAATGGGGCCTGCGCGTCGGGTCCAAGGCCTGCAATTGCTCGAGCAAATCGGGGATGGATCTGCAT
CCGTCCTCGTCGACTGTGAACGGATCCAGAGTACTGGTGATGGTACGGTCGTAAATAGGTCGGTCACGGCGAAACAGTGTGACGAGATCCTCTTGTGGGC
GGTCTCCTGAGTCTTTGGCGTCTGCCGAGTGCTTGGGAGCCTTACCTCCGAGCCACATCAAGTTGTCGTGGGCTTCGTGCTCGTATCGATCCATGAAGTC
ATAATAGCCGAACACTTCAATGTTCGCACTCAGGAATTGTAACCGGCCCTGTATGGCGCTGGCCTTCGCCTTGTGACGTGCTTCCGCTTTATTGGAGGGC
GCATAGAACGCCAGAACGAAGAAGGTGCGGCGGTGTTTCATCCACTGGCGCCACTGTTTGAGATGAAGGTGCGCGAAGCCGTTGGGGGCGTACCAATCAC
GCTGCCCGCGCCACGGATACGCCAAGCGGAAGGATCCCTTTCCTTCAGCGGCTGCCTGCTTTACCAAACGCGCAAGGTCGCGTCGGATACTGGCCGGTGT
GTCACAGGCCAAGTCGAACGAGAACGCAACGGGCGAAGGAGTCTTCTGTGCGCTGGCACGCTGCTTCTTGTTGGGCGGCGACATGGTCTTGGTGGAACTC
CGCGTGGCAGGGCGCTTGGAAGCCTTGGTGGGGACGGCCGAAGAAACAGTGGAGGAGGTGGCCGCGGTCATATGAGCAGGAGAGAAGACTTCATGCTCGA
GAGAGAGACCGACCTGCATGACTGACACCAGTGGCAGGAGGTGCACCGCCGTGGACAGAGCCGTAGCCTCGTCGAGGAGCACCGACACGGTGAGGTCGTC
GAGCGCGGAACCCCGTGGTCGCTCCATTCACCGCCAACAGGGACCGCATTCGGGCCCAGAAGTCAGCCTGAGCTCGGATGATCGAATCAGCATTCTAAGG
ATCGGCTCCATCTTCCATGATGAGCTGCTGGAGGAAGTGGGGGCTGTGAGGAAGAGTCTTGGTCATCTTAAGGGAGGGGTGTGCGCGGAGGAGCAAGTTC
GGGAATGAGCTCGGACGAGGATAGTGGTTCTGTGATGGATAGAATCTGACCCGGTTCGTCGGATTTCTGATCTCGTCACTTTCTGTCTACCTAATGCGGT
TCTTAAGAAGTAGGTGACTACCGGTCTGACCGGGGTCCAAACTGGCTACCGGTGGGCTACGCGAGAACGGTCGGAACTTCTCCTATTCGGATTGATGGAC
ATCTACTGAGACAGCTAGGACCGTTCTGGGTCTTACATTCAAGCGCTGGAAAGATAAAGACGAACGCCGGCTTAATAGCCGTTCTCACTCGTAGTCTACG
TTTCAGTTTTGCTACGAGACGGACAAAGGTGACGAGCGAAGACTGCCCCGGGATGGGTTAGATGAACGCTGGAGGTGGCCTCGAGGCTACCGTCGAAACC
ATCCTGCGATACAAGAAGGAGCGGTTGTGGCTGTGCGTCGGAGACATGCTATGGACGGTCACTGAACCCATTAGGAACGTCGCCGTCCGGTTGTTCGAAG
TCGTGGGTTTTGCGGTGTACAAGTGAACCTGTCTAGCCACAGCTTGCCTCCGCCGATACAGAAGTTATGTGAGGGGGAGGATGGTTCAGGAGCAGCCCTG
GAAGTCGCTATGGTGAAAGACTTACGAGGCGTTGTGAGCTACGCCGATGGTGGTGCTCCAAGCCCGCTGTGAGCACGAGATGGGTCTCGGGCGACTCCTA
TTCAAATGGTGTGACGCTTTCCACACCGATTAGTGTGTGTTTCTACCCGAATCGATACTGACTGACGGCAGGGAAACGGCGAAGTATCGGCAGGTAACGT
TAGTGGAGGTGCGTCGTTCTGTCGACCGATCTTGGATGCTACTACAGGTGCTAGAAGGAGTGACCTTGCTGGTGTTATACTCGATGTTCTGCGCTGTCCT
GTTTGCCTATGAATGCATGGAATGGGCGTGCCAAGGTCTACCTGGGGTATTGGCGGTAGTAGTGGTCGTCTATTTATTGGTGATGAATGGTGGTGAAAGG
GAGATGCTCTGTCGGACGGTCGCAGCCTGGAATGTAGTCATCCTGGCTGTAGTTGTAACTAGTCACTTGTGGAGATGATATGAATCGTCCACGGACGGTC
GATCGCCGATGAAGACGGCAATGGATGGTTATGCGGATTGGCAGCGACGCTGTGAGGAGCTGGACCATGTAACGGGCCAGGTGAGTGCCCGTCACTAGCT
TACACATAGCAGTGAGGAAGCGTCCAACAAGCTCAGGTATACTGAGACCAAGTGTTTAGTCTAGGGTAAAATCAACGCTGTTTTATTATTGGTACCGGTG
CGGATGGCCCTCGGATCCATGTGAACCACTCAAATGCAGGTCGACACCTGATTGATCGAAATGGGTCTGGCTCCTCACTTTCAACCAATCACAGGATGAC
AACGAGGCACACGCTAGCCGCGTGCCTTTGTCCCTACTTTGTAGATCTACCTATATAGATCTACCTACATATGTAAATGGGAGGGGCCCATTACAGACCA
AGTTCAGCGGCTCAGCGAGGCCTTTGGAAAATGGACGGGGGAAGCGGTTCCGCAAGTCGCCGACAGGTGCGAACGCGCAGCGGCCTGGTAGCTGAACAAC
GAGCGCTCCAAGAAAGAATGCAAGCGGATCGAGATGCGGCGTCTCGGCGAGTTTTCATCGGGGAGGAGGTTACGAGGGAAAATGGAGGTCACCGTATTGG
GCACGGTTCCGGCCGTCGGCGGGATGGGTCAACACTGACGCAACTTGAAGAGGCAGAGAGACAGGGCAGTCATCAGGCCCGGTCTCGGATTCCGGAAGGG
TACGACACCAACTGGGTCAAACACTATTGGTCGAAATGAGGTCTGTGGGACAGGGGAACGATCAACAGTGGCTTTTGAGCCTGCCCGGCCCCACAACCGA
TCTGGCGGCGTCGGCGGCACTCCGCAAAGAAGCAGCGGCCGGACGGGCGATATGACCCGTCGGCCCCGAGCCAAAGAACCTGAAGAAGACAAAGGACAAG
GACAAGAAGGAGAAGGGGTGTCGCGCGTGCAGTCATCACGCCGCGTGGGATGCGCTGGCGTTCTGTGGATGACTCGAGCAGTCGGGAGGCCGGCTTTCTC
CCGCTGAGAAGATAAAGAAGAAGGATCAGTCGTGAATTTACCCAGAAACCAACGTAACAAGCTGTATTTTTGCATTTACGGTTTGCTTGCGTCTGTTGTT
ATGACTCCTGTCTAGCTCCTCGCTTCTATACGGCACGGTTGAACCGTCCCAGTCCGGGACGACTCGTGATACCGCCTCTCAAGTTGATTGACGTAGTGTG
GCGAAGCGGGTTCACGAAAATTGCTGTCGCGATCCTAGGCTTGCTAGCGGTACGCCCGGACTGCGGACTATCGGAGAGGGTACTCCGTTGATCAAGCGTG
ATCGGAACCTTGTATTCACCTTGTGTACCCGACGGCGGGGCGGTTTACGCTCTGCCGGTGTTCACTGAATGCGTCGGTGGTGATCAAGGTGGAATGGGGA
GCTGGACTGCTCCTTGCGGGGAATGGGAGGTGACGGCCACGCGGGTATTCTTCACGCGGTCGCCGGTGGTGTGCCGATTGGGGCCTGGTGGGGCTTGATC
GGCGTGGGGGGTGTCCTTGGGTGTGTTCCTTTACGTGCTTGCCGCCTCATATGTCGGGGTCTTCTGGGGTGGATTAGCACCTGGCCAAGCGATCCTGGGG
CTTTCGTGTAACTGCCGTGCGCGACGAGGTGAGTCCGAAGTCGTCAGGAGGGCCAATATACTTCCCAGCCTGGAATCAGCGAACGCCACTTGAGTTGCAA
GGGAAATCTTTTTACTTAATGATCTTAGCTTACTATCCTCCCTCCCCTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTTCCGCGGATCCTTACTCC
GGAATGATTGCGGGTGTACCACCAAAGTGGCACGCCACGATCGTCATGCGCGATCGTAGTCGTGATCATGATCGCACCCTTGATCGCGATCGCATATCGA
AATGCTCGCACCACCTCCTGTACCGGTACAAACCGATAAAACTGACGGCACAATTGTACCCATCGGGTCTCCATACCCCTACCCCTCAGGTCCAATCCAA
TCCCTCCAAAGTCGGCCTTCATCAACCTTAGATCGTACGCCTTGTCCCGTCCGATCCTAGCCCATCGTTAGTCCATCACGAGATATCCAACATCCACTTC
ACCACAGTAGCAACTAGCCATGCATCTACTCTGAGCGAAGCCATCTCTCACTCACTTCATCTTTCTCCATCAACCTGGCAAGCGGTTGGTTGTTGTCCAT
CAATACATTAGGCTACCTTTCCGTGCGGGTTCAGCCCCCGCATCATAGTATTTTGGTGTTTTTGTGATATCCAGACCCGGAATGTACTACAGGGTGAAAA
CAGGCAATGGCTAGATTTGTCACCTTCATTTTCACTTAGCACCGGAGGAGTGTGGGATTCTGTCGAGTGGCTGTCCTCTTCATTGCTCAAAGGTCTTTCT
TCGCCAACGTCGTTCTCCACAGGCACCTTTTCTTCGATCCGGCGCTGGATTTGACGGGCCACCCGGACGTTTTCAGGGCACCTTGGATCCCTGTGGTGTA
GGGAAACTCATATTTTGGGATAGACCACTCATTCTGGCTCAGCTACATACGTCGTACCTAATCGGAGTTCGCACCTAAGCGGCAAACTCGGCGAAGCGGT
CGGACTCAGCGAGCACCAAGACTCGGCAATTCAGCGAGCGTATTCCACTTGGGAGTTATTCCAAGTGGGAGAGGATAAATCAGGAATCGGAGTGAAGGGT
CGGCTGAGATCCATAACGACCCGACTCGGCGAAGATCAACTAGGAAGCTGAGCGAAGAGTCGCAGGGAGATCTATAACGACTCCATTTCACTAGGTATTT
GTATAGGATCGATAGGAGACCAAAGGGGGGAGCCCGAAGGGACTCCCCGAAGACACAGAGATAACAAAACAGAGCAGAATCTTCTAAGTCCAAGAACAGC
GTACCCTTTCCCGGTAAGTCCCTGCGTGGGCTGGATTATGTCTGCCGTCGTTCCCCAAGAGGCATAGCTTGTAGGGGAATCGACTGGTAGCGCCAAGAGA
TCAAGGTCGGCCCCGGGTGGGCACTTCTCGCTACCAGCGAAGACAAACCTCGTCGAATCGACGAGTCGGTGGGTCTGCACAACCCAGGACACCGCAATCT
TCTAGCTGAGCGTACTCTGCGCTCGGTGACCTGTAAAAGCGCTCGCGCGCCGACGTCCATCCTTTGGTGGAGGTCACAGGGTTTGAGGAACGGAAGCTGC
CCCGCTCAGGCGAGCTTCTGGAGTTTGGATTGGTACTCAGCGAGAGCAGGGCCTCAACTGGACCCGGCTGGGCCGAACCGCAAAGGGAACCAACAGAACC
CTGCGCAAGCCCAACAACGCCGACCTGACTCGGCGAATTGTTGTGTTGTTGCGTGGAAGCCGCACTAACGAAGTTTTTGTGAATCACAACCCCACAACAG
GTGTCGCGACCCGGGATTCAGGAGTGTGCTTTGTTTTAGTAGGTACCAAGTAACCAAGTTTCGAGCAAAAAGTGAGAGAAGATGGTCAAAGGATCGACAA
GTCCGAGCGACGCAAGTCCGAGCGACGGTCGGAGGATCGCCGCTCGCTGAGTCGAGCTCGACGAGGGCAAGCGTCGCCGCCATGGAGGCAGATGTGACGC
GGACAGTCCAGTTCGACGAGTTCGACGACGATGACTAAGGAAGAGAGGAAGAAAAGAAGGATGATGGTGATGAGAAGACGGAGTACGACCACGTGAAGAC
GGCCGCCGAACTCCGCGAAGAAGTGGAAGAAATGTCGCTGCAAGTCAGCCGCGTAGGGAACCCTCGACCTGTCGAGCGCAGCCTAGCGGCAGAACTCAGC
GAAGATGCTGATGATGAACAAGGCCTGGCCCCGGGTGACCGACCGCCACTGGTTCCGAAGGCCACGAGGAACGCCGAGACTCCGAAGGCTAATCGAGTCC
TGGCCCGACTCGTCGAAGAAATGAGAACTGGGAGCCGGTGGATGAACATGTTCGCGCCCATGTACATGTGCCAGGCGAAATGGCCGGAACTCAGCGAGGA
GTTGAGCCAGCCAATCAATAGCCAGACTATTGAGCAACTCGTCGAGGACACAGTGCTGTTACTCCGAGCGATGGGCTACCGATGTAGCCACAAGCCCAGC
AAACCTGCGCTGACGACTTGTAATGTGAGTTCGGTCGGGGTCGAGCTGATGAGATGGAAGCGCAGGCTGAAAGACTTGTTCGGCATGCAAGGGGGACTTA
AGGGACAAGTGTCGAAGTCCCGCCGAGCTGATGAACTACTCGACGAGCAGAAGGCACCTCCACCCGCGACCGCACAACCGTACGTCACGGAGCCGTATGT
GTTCCCGGAACTCAGAGAGGACCCATCCAAAGTCCCGCTACCAAAGACCTCCGAGACCAAGCGCGGGGTGTTCCGACGCTCCGAAGGCACGCCGTACTTC
GCCGACTTGCACATGCCGTCTCCCAATAAGGTCAGAGAACAGAGCGGCCGACTTCCGATGGTGGAATTCCTGACGGATGAAGAAGCTGTGGAATTTAGAC
GCTTGGTGCGCGCTGATGCTGTAATGACGTCAGGCAGAGACGACGAGCTGAGCGAGGATGACAAATACGCGGATCGACGCGAATTTGACGAGTCACCGTA
TGACCACATTCGCCAACTCAGCTTCGATGGGGCTGAGAGCGACCGAGGTCAAGTATTGGAGATTCGGACGCATGCGCCGCTCGAAAAGATTGCAACCTTC
GATGGCAAGCGTTATCGTTCTGACGATGCGTTGCAATGGATCAAGCGATTCATCTATGAGATGAAAGGGACATGCAAGCCACAAGATGAGTGGTGCGAAC
CATTTTCGCTGAGTCTGGGCAAGGCTGCCAAGGGATGGTATCGCCAGCTTCCAAAGAAGACCCAGCGAAAGTGGAGTCTTCTCAGCGAAGCTTTCCTGGA
CTATTACTCTTCGCAATTCGACCAGTCGGCCAGGTCCCGCTACTACTCAGCGAGGCGTCGGGAAAACGAACAGATCTGCGACTTCTTGCTGCGACTGAAT
GGTTATGCCCGGACGGCACAGATCCAATATGAGAGAGAGGGCGCCGATGCCGCTGATCACGTCGAGCATTTCCTGCTAAGCTGCGGAGATGACGACGTCA
TGGACCTGCTGTATCCACAGCGACTCAGCGATATCTACAAAGTCGAGAAGATAACCAATCAGCGACTACTCGGCGAGAAGCGCAAGAAACAGCGCGACCG
CCTGAGCACGGCCCGTAGCCGAGAACCTCGGCGAGGGGACTCGAGAAGCGACCCAAGTCGTCGGAGCGAGTCTCGCAGAGATAACCGACGCGACGATCGC
CGAGACGACAGACGTGATCGGCGTGATGAACGCCGAAGCCGTCGAGAGGATGATAGCGATCGATGAGTCGCTTTGGCAAACGCTTCTGTGAGCGACCTGT
GGGCCGCACTCGACAACCGCCGAGCAATGGGAGACACTGATTTATACGACTAGTCGAATGGCGGAAGTGATCGTGATCAACTCAGCGAGTCTGAATCTGA
CTATGGATCCGACTACATCGACGCTGGTAATACCTGCGATCGACCCCGCTCGTCCAATGAGCGCGGGGAGTCATACCGAGCCCGTCAGAACTCAGCGAAT
CGCCCCGACCGTTTAAATGAACGTCGAAACCGACCGGATCGCCGGGACCGCCAAGAAGGGTCTCGCGAGCGACGAGCTTACGGCGCATGCGGAGCCCCAG
GCCACGACGCACACTTTTTGCCGCAAACGTTGCAAATTCTGCAAGCAAGTGCATGACGTGGGCCGGTGCGAGCTATTCCAGCGCTTCGAGAAATTCGCCA
AGTTCGTCAAGACGTCGGTCGACAAGTCCACCGTCCCGGAAGATCTCCAGGACATTTACTCGTCGAGCCATTTAAACTAGTGGGCTCGCCAACTCTGACT
GGGTTGGATAAAACCAGTCAGCTGAACCAGCGGTAGAAGCGAATTACGTGTTTGCTTTCGTTGGTGAAGCGGAACGGCCCGACGAGTGGAGGATGATTGA
CGGAGAGACGGAACGGATGGATATGGATAAGAACGACGGACTCGGCGAGTCGAACGAAGACGACGAACAAGTAATTGGTAGTATGGATATAACTCAGCGA
TCGATGATCTCGATTGGTCAAGCCAAGGGATGGAAACTGCTCCCTGGTGAGCGACTCGGTTGGTAGTCGTCGATGAAGTTCGATCGCCGAGTACGGATGC
GAGCTCTTGTTATGGGAGCTGTGAATGATGAACGAACCAAGATATTGTTGGATACTGGGGCAAACGTCTCCGCGGTAATTGAGGCCTTTGCAAGGAGGCT
ACGGTTGAAGCGGTTGACTAGCCTGGACAAAAGAATCGATGTTCAAGGAATAGCGAAGTCCAAAGTGGTGACTACTTCTCGAGCAATGGTTAAAATCACG
CTGGGATGGGAAGTAGCTTACGAATTCGAGGTGTGGATTATGCCCCACCACGCAGGGGTGGACCTGATCCTGGGCACCGACTTCATGATACCAGCTGGTA
CTAGGTTGGACCTGTACAACTCAACGGCAAAGCTTCCCGATGAGGTTGTAGTTCCTTTGATCAAGTCGTCGAGAGATTTCGACGAGACAGATTACGGGCG
TGAAGTAATCGGTGGTCCACCGGAATCATTAGATATTACAAGCCGAGCTATCGCCCAGTTCAAGCTTCGACAGAGGCAACCCAGCGAGTCAACTAACGAA
CTGTGGGCTCGACAGTTGAAAGGAGTGATCCCGACGATCGAACATAATGCGAACGGACGAGCAGTGCGAGTGTTGCTGACGAATATCTCGTCGAGACTCA
CGTGGTGTCCTGCTCACTTTCCGGTGATCATGTGGATTCCTCACGGAGTATTGCCACGGGACGAAGGGTATGTGCGAGTGAATTCAGCAAAATATCGTGA
TTGGCAAATACTTGCCTACGAAGGCGCTCTCGACAACAGGCTTCTCAAGCGCGAGCAGTGTTTGTACATGGAATGGCTGAGTCGACAACCTCCCGCTGTC
GAGCAACATCATTACAAAACTCCCAAGGCGATTCAGAAACGATCCAGTCGCAGCGAGTTCGCGAATGAAGCAGGAGTGCACACACCGGAAGAGCTCAGCG
AGACCCCGAACTTTCAAGGCAGTTCCGCGCTTGCTGACTACAGAAAAGAAAATGATGACTCGGCGAATCTACTGAAGTCAGACCCAGCGAGAGTTCACGA
CGATTCGCCCCTCAGTGAACCCGGAACAGACTCAGCGAGTTGGAATCCGGGACTCTACCCGGTCAATCACAAAAGAAGTTCGCTGAGTCTTACTGATGAA
CCACCGACGCTAACAGTACCTGCATCCGATGGAAGTATTGGTAGAGAGCACTTGGTAGGTTCTAAACACTCCATGGTCCGTCCACCTCCAAGCAACGGTA
AACAAAAACGGTACTCCAGCGGGATGGACAGAGGTGACCAATGGGACCCAGGTGAAGCTGACTCTACAGTTTCGACGCGTGATCGTCGGACGACGCTGTC
CGAAGCTAACACGGCGAGTGAATGGTTGGATCCCGAGTTATTGCACACCCGAGTGCCACGTGATTTTGAGGGGCACGTCCTGTCTTTCGACGGGTCAGCG
AAACCGGAGAAGTACGGCGGCTACGGGAGTTGCTCGTGGATTTTGTGGCGTTTACCGAATTGGGACATTGTGATCGCTGCGAGTGCTCACCTGCCGTCAA
CAACAGTTAATATCGCTGAGTACACCGGGATGAACCACGGAGTCCTCGCGGCACTGGAACGAGGGGTGACTGACCTGATCGTCGTGGGCGACTCCAGGCT
CGCAATCCAGCAATCCATGGGGGTGATAGCATGCAAGAAGGAGACCCTGCAAATGGAATTAGCACGCCACAAAGAACTCGTCGAACGCCTGAATTCAGTC
CTATACCTCATGTGGTCCGCTGCTATAACTCGGCCGCAGATGCATTAGCCACCGAAGCTCTTGAAGCCATGGCAGGACACGTTGTCCTCAGTGGAGATCG
AAAAGCAGAGCTGCGAACGCTAAACCGGATCCAAGAGAAGCTGTACGCCGTCACAGACCTAACCGAAGGAGAAGAAATTCCTAAAGTCTCGGCGACCACA
CGAAGTCAAGCCCGTCAGACTCGCCGAGTCAGATTCGCCGGGGATGAGCAAGACCACCGAGCGAATGAACCAACAACGCCAGTAGCGTTAAGAGGAAACG
ACTCACCAAGGCTCACCGATGACAGCGATAAATACGACGAGTTCGAAGCAATGTACAAGCCTCCAGGAACTCAAAGAGTGATTGAACAAAGTTACACTAC
AATTGAGCGACAAGAATCACCAAGCGCCCAGGACATTGATCCGTTAGCCGTTCAGACAGAACGGCGGGAACGAATATCGGCAGCACAAGACGAAGAATGC
AAGTGGTCAGACCTGAAACAATACCTACGAGGTGAATTCGACGAGCTCACTCGACGAAGAGCAGGAAACGCAGGCAAAGTTTCTGACCGCTTCGTGCTCA
GCGAAGATGACCTACTGTACTATATGGGTCGCCGACGAGAGCGAAGAGAACCCAGCGAAGAAGACATGAAGCTGAGACTGGTAGTTCCGACCACGCTCAT
CGACGAAATCTTAGCGAATTGTCATAACTCCATCGAGGGAGGGCACCAAGGTATCGTGAAAACGTATCACAGGGTGAAGACAGACTATTATTGGATCGGA
TTGTATGCCGATGTGGTCAAGCCCGTTCAAGCGTGCGAAGACTGCAATACCAGCAAGAGCAAATCCCACCTACGAGGGCATTCGCCAGGTAACGTAGTGT
CAGACAGACCATTCCAGATCGTGTCGATGGATTTCGTTATTCCACTGCCAAAGACTCAGCGAGAGAACACCGCACTGCTCCTCTTCCAGGATCACTTTAC
TGGATTCGTGATCGCCAAGGCAATGAGCGACACAGGGGCACTTGAAGTGGCAAAGGCATGTGAAGAATGCATTTTTCGTCGGTTTGGAGCTCCTTCGCTC
ATTCGACACGATAGAGATCCAAGATTCATGAGCGAAGTCTTCCAGACATTTTCCGAGATGATGCAGTCTAAGTCACGAGCCACCTTGAGTTATCGACCTC
AAGCAAATGGTCAACAAGAGCGTAGCGTCAAGACGATGATTTAGACAGTACGAGTCTACGTAGAAGACCCGTTACAAGCTGACTGGGATGACATCGCTGA
AAAACTCGTCCACGCTATCAACAACTCAAGAGATTCGACTCGGCGAGAAACACCATTTTACTTGGTACACGGCTAGGATGCTCAGTCTAAACTCAAATCG
ATGACTTCATCCATTCGCCGAGCCTCAAAGAGCCCAGCGAAACAAACGACGTCAGCAAACGCTAAAGAATGGCGCAGAGAAGCAAACCGGCAGTGAGAAA
TCGCACTCATT