Description :
From Genome Similarity Track
Location :
Scaffold_1673:1680- 3643
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1673-snap-gene-0.4Pre-mRNA-splicing factor SF2
Pytul_var.sporangiiferummaker-pug3_contig_1673-fgenesh-gene-0.3RL38, ribosomal protein 38 60S large ribosomal subunit

Sequence
1963 bases(100 bases per row)
ATGTGCCATCATGCTTCGCCTGCCTCCACCCACTACCACCACTCCAGCATGTCGCCGCACCCGCTGCCGCCCTCGCTCGCTATTGCTCTCCACGTGTGCA
CCAACCAACCAATGCCCGCCTTCTCTTCGTCTGCCCTCTGCTTCTCGTCGTACTCTAGGATTTCGAAGACCCACGTGACGCCGATGATGCCATTCGCTCG
ATGGACGGACGCGATTTCCTCGGTGGACGGTAAGAAAGCGACAAAAAAAATGTGTGCATGCATATCGCTCCTGGAACTGACATTTGCTATTTTGTGTGTG
TGTCTTGCAGCATTCGTGTGGAACTAGCCCGTGGTGGCTCTCGCCGTGATGACCGTGGAGGCCGTGATGGTGGTCGTGATCGTGACGGTGGCCGTGGCGG
CGATCGCTTCGAACGCAATGGTACGCTTTGCATATTCATTGGTAAAAAGATGCGTAGATAGTGGTTGTTGACTGACTTTGTAATCGTTGTATACGTAGCT
CGCACTCCTCCAACGCGCACGGAATTCCGTGTGCGTGTATCGGATCTTCCTCGTGGAACGGACTGGCGCAACGTGAAGGACTTCCTCCGTTCGGGTGGTG
AAGTGACCTACTGCAACATCGAGTCTGACGGCACTGCGTACGTAGACCATATTGTGATCCTTATGCCTGAATCAGTGTGTGAGCGAAGTCAACTAACTGT
TTTTTTTTTATTTCTGCATCCGCTCTTGCTGATCAGTCTTGCTGAATTCCAGTCCAAGGACGACATGGAGAACGCCATCAAGAAGTTGGATGATACTGAG
TTCCGTGGCAACTACGTCCGCATCACTGCCGAGGGCTCGGACCGTCGCTCGCGTTCCCGATCGCCACCTCGTGACCGCTCTCCTCGTCGCTCGCGCTCGC
GCTCGGTGTCCCCAGCGGCCGCCCACTCGCCACCTCCACGCAAGAACTCGGTCTAAGTGGAACGCCGGACCTGATCTCGTCGTGTGCATTCTTTCGTTGT
CGGTAGCAAAGGAAGCAAGTAGGTACCAGACATCGAGACTCCAAGATATTTTTTTGCTTTTGAATATTCGTTCCGCCCCCTTTACTTCATTTGCCTTCAG
CTGCAATGTCTCGTATCGGCTTTGTTTATGAATGCTTCCATTGCGTTCCCACCTTCACAACACAAAATGTTGCCACTCTGCTCAAGTCGTGTGCTGATGG
ACACAATGATGCCCCATGGATTTTGTAGAGAGAGCAGTGCAGTGCATTAACCTTGCACTTGAATACTCACACTCAGGCTGTTGTTAGAAATGCTTGCGTT
TGCACACAATGGAAGAAGTTGAACGTGTAGCCATCTCAATCATCAGGGGTTTACTCGGGCTTTCGAGCGATGACGGCAAAGAGAAATAAATATAGGAAGA
CAGTGAGGTCAAAACAAAAACACACTGAATGAAGAGAAGAAGCACCAAAACGGATTCTTTCGACTTGATAAAATTCTGCCGAATTTTGGCATTCGAGCCC
TCCTTCCTCGTCACGACCGTGCTGAAGGAAAAAGAGCCTTTATACGAGCGCCAGCCTAAGTAAATAGACTACCACACGCCGAAAAGAAGCAGTAGAAGAC
CGGTCTGAATATGCCTACGACGTGGAGCTGCTCATCCTTAAATGTCCTTGCGTTGAAGTCCTGCATGGATGCAAAGAGAGAACGAGAGTAAGAGAAACAG
AGTGTCAATCATGGTGGATAGACCACAACGCCAGTGAAAACATAGAAACCTGAGCCGTACCTGGTGGAAGGGATTGAGTGAGCTTGTCGGCCTTTTCAGC
GTCAGTCACGACCAAGGTGTACAAGTACTTGGAGCAACGAATCTTGAACTTCACGACCTTGTCGGCCTTCTTGATCTTCACCGAACGAGCGTCTTTTCGG
CGAGCCTTCTGAAGGAAGTCGCGGATATCAGTGATTTGCTTTGGCTGCACAGTGGGAGAAACG