Description :
From Genome Similarity Track
Location :
Scaffold_997:1680- 2759
Transcript NameFunction/comments
Phyta_totarag11692hypothetical protein

Sequence
1079 bases(100 bases per row)
TGGAAGGGCGAATGATGCGCCCGTTAAGCTTATTCCTCGATCTCACCTACCATGTTTTGTTACCACCAATCATAATGTTCATTTGAAAGGCTGGGTGTAA
TTTTGGGCGAGATGCGGTTATTTACTGCGCCGAAGCCATAATCCGTGACCATAAAACTGTTTTTGAATCCAGAGCGTGTACCGAAACGGGCCTACACTGC
TTTCTATCTGCCTTTCCTGCTAGCCGTTCTTACGAATCAAAATCTAAGACGCATGCAGTTCTATCGATACGCCCGttactggagcagcaatgAGAACAGA
CTGCAAAGACTAGGAAGACAGAAAGCTAGTGCAGATAGCGTTCTAGTTCGAGAGCGAGCGCCTGCGCATCATGTGAGACTATTTAGCGCGGCGAATGCAA
TCTCAGCGCActgcgctccagctccgattGAGAATGGCCTGCCTCAAGAGAGCGTACGGCAGGTTCATCGGCGATTTCTCTCCTTGTTTCTTCGTAGGCT
TCTCGCATTGCCGTCTATTAACAGCATTGGGGCCTCCACCCCCTCCTCCTATCATTTCATCGGCCCAACATCCGAATACCTTATCATTAGCAAGTGAACA
ACCCGGAGAACAATGGGGACGCGGAGGCCGAGGTGGACGTGGCAcccgtgctgctgaacgTGCGGATGGCGAGGCTGCGGTGACAGGTACAGTGGTGCTA
GCGTCCTCATGATGCAGGCTAGGCAGACTGACTAACGGATCGTgtgcttggtggtggcgttgcaGGTGGTGAACATGACGTTGGTGGGGCCTGTGACGTC
CGTGGATCTGCTTTACATGAATAACGACATGTACGACAGTCTCTGCTCACCGCGCATGAAGCGGCGCTGGCTATCGCTTCGATCTTGGATGCAGTTAGCG
GCCGTGCTCACGACAATGCTGGAGAGATCCTACCGCCGGGAGCGGCTGCGCTGATCGACGCAATTGGTCCGGTGGGAGATGATGATATTTTTCTTGATGT
TGGGGCTGGTATCGGCAACGTGCTAGCTCAAGTTGCGCTTACGACAAATGTCAGTGCCAGCGTTGGCATCGACCTTCGA