Description :
From Genome Similarity Track
Location :
Scaffold_4030:168- 2581
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4030-snap-gene-0.1DNA ligase

Sequence
2413 bases(100 bases per row)
AAGACGAAGACGAAGAGGACGTGGACATGGAGGAGGAAGAGGACGAAGAGGAGAAAGCCACGGCTAAGAAGAAGAATACGCCTAGGAAGCAGACGCCTAC
CAAGGCTGCGGCCGACGCCAAAAAGTCCGTGGCCAACACCGACACAGCCGTGGCGCCCTTGGAGGACGACGTCGAGAGCATTCCGTACACGGCATTGGCT
GCGCTGTTCAGCAAGATTGAAATCTCGTCCAGTCGGCTCGTGATCCAGGATCTGCTGTCCAACTTTTTCCGCCAAGTGATCCGCAAGGCGCCGCAGGATC
TGCTCGCGTGTATCTACTTGTGCGTGTGTACTGATTTGGCACCACCGTTCGAGAACCTCAAGATCGGCATTGGCGATGCGATCTTGATGAAGGCGATCGG
TGAAGCGACGGGGACCAACCCGAAGTTCATCAAGGACATGTACCAGAAAGAAGGGGACTTGGGCAAGGTCGCCCAGAACGCGCGGTCCAAGCAGAACACG
CTGTCGTTCGCCACGCTCATGCCAGCGGCCAAGACGCAGGTGCTGAGTGTGCCCGAAATCTTTAACCAGTTTGTCAAGATTGCCAAGATGACGGGCAACA
ATTCGCAGCAGCAGAAGTGCTCGATCATTAAGGGGCTTTTGGTCAAGTGCGAGAAGGACAAGAAGGCTAGCAGTAGCAGCGCGAGTCCGAAGAGCGAGCA
GACCGCCGAGGCCGCCAAGTACATTATTCGCGGACTGCAGGGCAAGCTGCGCATTGGGCTAGCCGAGAAGTCGATTCTCATGGGGCTCACGTACGCATTC
ATGCTCGAGAAAGACGCCAAAGACAAGGAGAAGCAGGAAAAGGCCCTGGCGTTTGTCAAGAAGGCCTTTGCGGAGTGTCCGAGTTACAACGCACTGGTCA
AGGCGTTCCAGGACGTGCAGACTCAGGTCGAGACAACGCCGTTCTTGAAGGTCGAAGACTTTGCCAAGGTCGCCGACGCGTGCGTGCTGACACCGGGCAC
GCCTGTGTCCCCGATGCTGGCGCGGCCGACCAAGGCTTACGCCATGGTCTTTGACCGCTTCCAGGGCCAGCCGTTCACGTGCGAGTACAAGTACGACGGC
GAGCGCGCGCAAATCCACATTCTTCCGACTGGCGAAATCGCCATTTTCTCTCGAAATTTCGAAAATTCGACAGAGCGCTTTCCCGATGTCAAGCTAATGA
TCGCCAAGGCCGCCAAGAAGGCCCAGATCACGAGCTGTATCGTTGATGCCGAGGTCGTAGCCGTCGACAAGGCGACCAATACGCGGCTGCCGTTCCAGGT
GCTGAGTACGCGGTCGCGTAAGAACGTCAAGGTCGAAGATATCAAGGTGCCCGTGTGTATCTATGCGTTCGACCTGCTCTTCCTCAATGGCGAGTCGCTG
CTCAAGGAGCCGCTGGGCAAGCGACGCGAGATTCTCAAGACGCAGTTTGAGATTGAAGACGGCTCGTTCGAGTTGGCGACGTCACTGGATGTGGACGGCG
TCATGCCCGGCACGGACGACGCCGAGGCCATGGAGATCGCCGTGGACAAGGTCCGCACGTTCTTGGAAGAAGCGGTCAAGGAAAACTGCGAAGGGCTCAT
GGTCAAGACGCTCGAAAAGGACGCGACGTACGAGCCGGCGAACCGTTCCCACAAGTGGCTCAAGCTGAAAAAGGACTACTTGGATGGCATTGGTGACTCG
ACCGATCTCGTGCCCATTGGTGCGTTCCACGGGCGCGGCAAACGCACGGGCGTGTACGGCGCCTACTTGCTGGCGTGCTATGATCCGGAGACGGAGATGT
ACCAGCCGATCACGAAGCTTGGCACGGGGCTCAACGACGAGCAGCTCAAGGAATTCCATGCACAGCTCAAGGAAAAAGTCACGGACAAGCCCCATCAGGA
CTACGCCATCACCGATGCTATCAAGCCCGATGTGTGGTTCGAGCCGAGTGTCGTGTGGGAGATTCTCGGGGCCGACCTGTCGATCTCGCCCAAGTACACT
GCCGCCATGGGCCACGTCGCAAAGGACAAGGGCATTTCACTTCGCTTCCCACGGTTCATTCGCATTCGCGACGATAAGAACACGACCCAGGCGACGTCCT
CTTCGCAGGTGAGTCCTGCGATCCTACTCCGTTTTGACTGTGAAATTTATATCCACTGACGTTGGTTTGTTCATGCAGATTGCCGACTTGTATCGAGCGC
AAGGGTTGGCAACCGTGACAGGGGAAGAGGACGAGGATGATATGCTCATTTAACAATTATACTCTCTTGCCGTACGGTAATCTTTCTCTTCTTTGACTCA
CGCCAAGCAGTCGGCCAGCAGCTGCCACTCACTTACGTCCACGCGGCTGGGCTCGCTCAGCACCAGCGGTTCGAGGTCCAGTAGATCGTTTACTTTGGCG
TCATGGGGGAAGA