Description :
From Genome Similarity Track
Location :
Scaffold_427:168- 2360
Sequence
2192 bases(100 bases per row)
GGCAATGACCATTGCCGAAGGAACAGATGATTACATCGACCCGTTATCCTACAAGCGAGCCAAGTGAGACATGCACGTGGGAGCAGGTCGCCTGACTACA
GCCCAGAATTTTGTGTGCGTAAGTCAAGAGGTGTTTTGGCGCGTAGTTCATGCTTACAATAGGTTTAAGACGGCCACCATCTCTGTGCAAACACCGATCC
CGCGAAAAAGATGTTCTATTGATCTCAATAGGGAATTCAACTATCTTTTCGCATTATATTTGAAGGATGGCTACTACTCATGAATGAGACCGATGTAGCC
AATACGGCAATTACAAGGGTTAAAAATGCACCACCGACATTCAACCGGGTGGTCGATCACGTTATGCGTCCACACCGTGCCTAAAGTGCCTCATTACTCT
GACGATGTGTTCGTTCATATAAAGGTCAAGGACGAATTGAGTGAGACTGAAGCACAAAAACATCATTTGGAAGTTGTGTTGTAGACGCTGGGTAACGCCC
AAATGTACGTCGACTTGCTAAAGTGCGTCATAGGGGTTTCGAAAATACATGTACTGGGCTGCATCGTGGGTAAACACGGTGTTAGATCAGACCCAGAGAG
GGTTGAAGCTATTTAGGGAATGGCCGGTTCCACGACATGTGAAGGATCTGCGTCAGCTCCTTGGGCTTGATAACTACTTCCACAAATATAGCAATAGTTA
CGCAGGGCCAACCAAACCAATGTCTGACCTCTTAAAAAGGACGCAGAGTGGACTTGGTATGAGGCTCAAGTAGATGCTTTCAATTCAGTGAAGCAGTCAC
TTGTATAGGCTCCGGTCTTGGCTTTGCCAGACGCGGATAAGCCCTTTAGTGCTGTCTCCAGTGCGAGTACTTTCGCTACCGGCAGTGCACTTATCTGTAA
GGATGATGACGGTATTGATAGTGTCATCTCGCATCAGTCCCGACATTTAAAGGCTGCAGAGCTGAATTACCCCGTGTACGACAAGGAGCTACTTTCCGTA
GAGTATGCTCTTGGTAAGTTTCGATTGCACCTATTGGGCACCGAACCTTTTGTAGTTTACACAGATCACGCATCATTGCGGACCGCGATAAACTCGCCGC
ATCTATCACCTGGGATGACGAGGCGGCTTACATTCTTCTCAGATTTTATTTGTCGAGTTGAATACAAGCCGGGGAAGTCGAATGTCTTGTCTGACACGAT
ATCTCGCAGACCGGACTTCGAGTAACGAAACCTTGAAGACGTGTCTGGTGCTGACGTACGAGTTGAGTAGTCAACACTGGCAGCCTTACGGATTGACCAT
GTGACAAACACTCTGGCCTCTGATATAAAGAAGAGCTACATGCAGGACGAACGTTGTCGTCTACTTATAGATCACTTTGGTGAACGAAAAGTTAATCTTT
CGTCACACTTATGGGCGAAGCTTAACCGCTTTAGTTATAGTGATGTCCTGTTATGGCATCAGCTATCACCCTGTGATCCATTGAGAACCTGTGCCCCCCG
TGATACAGATCTCAAACAGAAGATTCTCTACGATCTCCATGATGCACCATCAAGTGGTCATCTGGACCGTGAGAAGACATTCTTACAAGTGTCAGATGAA
TTTTGGTGGCCACACTATATAGGTGGGTAGTCAGTTATATTCGATCATGCGAAGAGTGTCAGCACGTAAAGCCTGCACTTTCTAGTAGTGCGCCACTGAA
GCCACTACCGATACCAACTGATTGTTAGAAGTCGGTCAGTTTGGACTTCATGTTGGAAATGCCGCCTGATCATAAGGGCAGGACTGTTCAGGTCGTCTTT
GTTGACCGACTGAGCAAAATGGTGCATTTAGCACCGTGTAGCACCAAGATCTCAGGGAAGGAGGCAGCTTTCTTATTCCTGGATCACGTGTATCGGCTAC
ACGGGATGCCCGAGTCCATAGTTTCGGATCGGGATCCACGTTTTACGTCAGGGTTTTGGTGCCATGTGTATGGGCTGCTTGATAGCAAGCTCCACATGTC
TACCGCCGATCATCTCCAAACCGATGGCCAGACCGAAAGGGCCAATCGTGTTGTGTCGGATGTATTGCGCACAATAGCAACTACCAAGGAGTGGATCAAA
CATTTACCATTTGTGGATTTTGCTATTAACAACAGTGTTCTCGCCAGTACGGGTGAAACACCATTTTATGTGAACGGACTGCGCCATCCTCG