Description :
From Genome Similarity Track
Location :
Scaffold_2556:168- 1901
Transcript NameFunction/comments
Phyag_g12587conserved hypothetical protein

Sequence
1733 bases(100 bases per row)
TCTCAGGCCGATTCCGTGGCGGTCGAGGCGCTAGTTTGAActtgttgagcttgtcgGATACTATTGCGTTCGgcttggaggtggcgacaCAGACTCTCGA
GCTTCTTAACCTTCTCCTGCAATTTCAACGTCTCCTCCGTTGATGTCACCTTGTCTTGGATAGAAGCGATCGCATCGTTGTCATACGCAGCACACTTCTT
TCGAAGCGCAaggttctccttctcgagcttcttggtcgtTTTTGCCATCTTGTCCATCTCTTCTCGGAACGTAGTGAACATTTGGTTGCTCTTCGTCAGG
GTTTCTtgcaccacgtcgaacttCTCCGAGTACGAGTTGAGCTGTGCTTGCAACTGAATCTCGCGGTCGGAAAACTCTTTAGCCTTATCAAGCGTAATTT
TCACTTTTTCAGCCTCGCGCGAGGTGAGCTCAACctgatgttgcagcttcgtTTCCGCAAGTTGAACAGTCAGATCTTTAGCCTCTAACTGTCGTTGAAA
GTGTTCTTCACGCGTGGTATACTGCTCGAGGAATGTTTTTAACTTGTGCTGAAGGCTACAAATTTTATAGCGAAATGTGAGTTTGGACAATAACAACGAT
GCAATCTAGCGCGAGACACGTACTTTTCGTTCTCTTTCAGCGAGGCCACGTAGTCCTGGCCCTGCTTATCCATTTTGGCACTCACTTCTTCGATCGTCTT
TTGGAATTGCGCCGACAGCTCGCGTCTGTATAACCAAAAGCGTTAGCATCGTACTGTGTAGCTGAATATTACTAGTTCCCGATGCGCACGTACCTCTTCT
GgtcctcttcatctgcaaTACGACGGCTTTCGCTCTGCAAAAACACAACAGTAATACGATCAATACATCCGCTGTCGATGCGCTAAAGTCATTCTACGTT
CTTGCCCACGCACCACGATGAGtttgttctgcttctgcaaCTCCCGACAAAGCTGCTCCAACTTGGCCTTGGAcgtgctcgtcttcatcagctCCGTGCT
CACTACAACGAACACATTAGTGTTAGCGCGAGACAAAGCTCTCCAGTCGACGAACGACGTGCCAACAGCCACGCACCTGCGCTTttgcgctgcttgagca
gGACGCACTTGGAATTTAACTCCccgatcttcttctgcatcaactgcagctgctcacTCTGTCATAATCCACACCATCAGTCCCCCCACCTCACCTCCAT
CTGTCTCTGGATCTAAACACCTTCGTACCGCTTGGTTGATACTATGGACGAGTTGCGCCACCTTTTCCTCGGCTGTTATCTCCTCATTGTCCTGCAGAAT
attggccttctccttcagctgcgcCGACAGCGTCTCGTCCTGGTAGATGCCTGTGTCATAATAATGCAAAACTCCTTCAGCAAAAGTTGATCTCTGAGAG
TTGTGCTGCTCACCCGACAGGTCGATGGGCGCCTCCAGgttctcgtcgccgcccACTTCGATCTCCGCGATCTTCcccgccagcagctcccgcaGCGCGT
CCTCTCGATTGGCCTTCGAGTTGCGTTTGCTGTGCACGTGATGGCGACCAGGAGACGCCgcggacgacggcgaccgCTTGAGCTCTCCGCCTTTGCTGGA
ACCGTCGCCTTTGCCGCGCTTGGCcttgtgcttgtgcttgaggCTCTTCGTCTCGCGCCCCAGCTGCTTCAGTTCCAGGCTCGGGGGCTCCATGCACGAC
GGAGAGATGGCGCGCGTCTGCTCGTCCGACATC