Description :
From Genome Similarity Track
Location :
Scaffold_2148:168- 1684
Transcript NameFunction/comments
Phymu_g13917conserved hypothetical protein

Sequence
1516 bases(100 bases per row)
CAGAAACTGgcactgctgttgctgctctcgtCCGCTCTTCTATACAACGTAGATGGAGAGATCAATGGAGatgcagtggagaagctgcactgggtggaga
aggtggccCAAGTGCTTCGAATCAAGGCTATGCAGGACCAAGAGGCTGTCGGTGGGGATTTTTACTCGTCTTTCCTGCCTAATTGCTGTGCTAACAGTCG
ATTTCattgtggctgcagctaGTGAGTTCCACGGACACGCGCCCAAGTTCATTTGGCTGGCCAGGAACTTCAAAGTCAAATGGTTGAAGAACGCGGAGGG
GCAGAAATTGACCCCCACGCAGTACTTTGAGCAGTCTCTGGCTCCTGAAGGAGGCTACGGAGACGCAGCTACCAAGAGGAACACGCTGCGTATGTATCTG
GAGACCTATTTCCCTGTTCGAGACTGTGTGGTGTTGAGTCGTGCTGTGGAGGGCAACGGGACGGAAGTTGTGCCGCCTGAGACGCCACGGAGTGAGCTGC
GCACACAGTTTGTCGAGTCTGTTGACCACTTGTATGCGAACTTTTTGTCAGACAAgggccagcagctcccgtCAAAGCAGTTGATGGGCCTCCAGCTACG
CCCTGGGCAATTCGTGTCTGTGCTCGAGTCGTACATTGCTTCAATCAATGCTGGACAACTCCCGACTATGCAGAAGGCGTCaaacgcgctgctggagcgg
GAGGTTGCCGAATCCTTTGATGTGGCGAAACAGATTTACAGTAAAGAGATGCTAGCGGCAACAGAATGCAATGGGAAGAAGACTCACACCGAGAGAAATC
TGTATCTCGCCCATTCCCGCGGTGTTCAGTCGGCCATGGCCCACATTCGTGAGATGCGCTCACAGCTTCCAGAGAGACTGCAGAAAACGTTGGTCAAGGA
CAGTGTAGCTGGATGGGAAGCTCAAGTGAAGCGCGACTTCATCGAGACGCTAGAGCGCAACACAACGTTATCAGCCGAAATCTGCACAAAGATTCTCGAG
CGTGTTCTCCCTCAGAACCTTGAGGCGATGGCCACGGAGCTCGCCGAGAGACCCCGAGAGGGCTTTTCCGATGGTTTAATCCGGCTGCTGACTCAGTACA
AGTCAGATCTACGAAGCGCACTAGACGAGTATGCACAGCAAAGCAGCGGACCGGCAGTGGATTCTTGTCTAGAAGAAGCTCTGCTCCATTCTGTACGCGA
ATCCATCCAGAAGTGGAGTCGAATGGTGCTCCAGCAGTACAAAATGCATATGCAGAGCTGGCAGGAGGAGAATGAGAAGCTTCATCACGAGTACGAGGCT
ATTGTGGTGCAGGAGGCAGAAGTGACCACCGCTGCTAGCGACCAGAAGTGTTCGTACGAGGAGAAATTGGCCTTTGTCACGGAGCAGCTGTCTGAACTGC
GTCGAACGCTCCACAGTGAACTTGACAGCAAAAAGAGTGAGTTGGAACGTCTGACGACCGAGATCACGACCATGAACCTGAAGCATGAAGTGCGAGTGAA
GAACGCTGAGAGTGAC