Description :
From Genome Similarity Track
Location :
Scaffold_79:168- 1544
Sequence
1376 bases(100 bases per row)
GTAATCTTGATGTTGGACGAGCAAAAACCATGCAGCAACCCGATATTGTGCTTGTTGATGCGATAAGTCTCGTCCATGTGCACCATCATCGTCTTTCTTT
CGATCATTTGCAGCTCGGGAACATTCTCTGGAACTAGAAGCAGATGTGGGATTCTACGCTCATCGTTCTGCCTGACATGACATCTGGCGTCATCTCTCTG
CAGCTGCATTATTAAAACTGTCATTTCATCTTGCCCTGCAAGAAGACGCTTCTTCTCCTTCTGTTTCAAGTTTGCAATAACTTTTCCGATCAGCCTGCAC
ATGACGCCAAACCTGAGCTTCATGGCTTCAACAATCTCGCTTGTTTTTTTATCTGTGCAAATCAATGTCATAGCATACTCCATATGCTCGGGTGTGAGCT
GTCACGAGTTAGGATCAGGTGTAATATCAAAGCTGGCAGGATGATTATGGACCCCTATGAAATCAATTGTGACTTTTCCGTCCATACCTTTACTGATAGC
CGCTTTCCACTTGCAGCCTAACAAGCGTAAGTTCGTATTTCTACGACAATTGTCTTTTGAAGGGCCACAGCTGTCAAGCTTTCCTGACAAGGAGCATGGA
CAGTATTGTGAGATAACCCCAGAACTTTCGTTCTTCTTCCCTTGTTTGGTTGCAAAACTGTGATTATGACAAGTTTGACGCAAACATTTGTTTGCTTCTT
CCGAAGAGGAAAAAACCCTTCCTGCAAAACAACCTTGTGAGATATTGGCAACGCCTGTGGGTATCACAGAAGACTGAACTACTTTTGTTCCATCACTAGC
AAAATTGGGCGGCTCTTCATACCCATCCCTCCTTCTTCAGTTTCGTCAAGATCATCATATCTATCATCAGAAAAGGGATCATATAAGCCGCAACTTCCTC
TGTCTTCACGTCTGTCACCCACGGAACTTTCAAAAATTGAATCACACGCGTTCATTATCGACGCAAGATTGTCCATTTGTTAAACGATCGGTCGGTTCAG
TTTCGGATCGTGTGATGATATGAAAAAGTTGTCTTAAAGAATATTTAACACGCTATCTGATGTTATAATGCCGAACTTCTAGCAAGGAAATCAACCAATA
CATAATCTGATATTGTGTCGTGAATGAGGTCAGAAATTTAAAAAGAAACTTATAACACGCTAATCACGTTAATAATCACTTATATCAGTGAGCACGGGAT
TTGGGCACGGTGCAGATTTTCGTTGGGTACGGTCCAGACAAACCCTAAAAACATAGGTGTTCGCCTAAAAAACTGTGTTACGGTTAGGCTATCGATTAGC
CTTATTTAATATACCAAACGGGGTTAAGAAAAGCTCAATTTTATTGAACTTCAATGGAAACGTTTCTAAGATAAGT