Description :
From Genome Similarity Track
Location :
Scaffold_1:1679829- 1681325
Transcript NameFunction/comments
Aphas_H257_00596Hypothetical protein

Sequence
1496 bases(100 bases per row)
TGGGACTCCCTGCGGTCCAACCGCTATTACGACCTCCTCAAGGAATTTGAGGACGTCTTCCCCGACGAATGCCCTGCCGCCTCCCCGTCGACAAGGGCGT
TCAACACGAGATTGACCTCGTGCCCGGCGATAAGTATTGCGTCACTCGGCAATGGCCGCTGCCTCGCGACCAAGTCGACGCCATCGACGCCTTCTTCGCG
GCCTACAAGGTGACGGGTCACGTCCGCGAGAGCATTTCCCCTCAAAGCAGCCCGACCTTCTGTGTGAAGAAGCCCGGGGGGGAATGGCATATAGTACACG
CCTTCAACAAATTGAACGCGGTCACGATTCCGGCACATACGCCGATTCCTCGCAAAGACGTTATTATCGACGGCATGGGTCGATCTACCAGTTTCTCCAC
CATCGACCTACGCGATGGGTTTTACCAAATCCTGATACGTCTGTGCGACGTCCCTAAAACGGCAGTTCCACGCCGAGCGGCATGTTATGGGAGTGGCTGG
TCATGCCACAGGGACTCTCCAACTCCCCGGCGACGTTCAACTACATGGCCACCGCGAAGTTCCGCGCGTTTCGCGACTTCGCACTGTCGTACTTTGAAAA
CATGTGCTGTACGTTCACAGCTGCACTTCGACGGCGCAGTCCGATTGCGACGTTCACCGCGGCCACCTTAGCCAGGTGAAGTCCTCCGTGACAACGGACC
ACTGGTTTTTCGCCCCATTTTGCGGTCCATCTTCAACACCCTCGCCTCCCTCCGATGCTCGATGGTTCGGTCTCAAGTGGGGGTGGAATTACTTCGCGGC
TCTCTTCTGTGGGCGTACTCCCCAACGCCCCCAGCCGCACTTTCCAAACCATCCAGAGCTTCCTCACCCGCCAAGTCTCTGTCATGCAACATATCCAAGA
CAGCATCGCTACCGCTCTACAGAGCTAATCAACTCAAGCCAAGAAGCATGGCCGTTCAAACCTCGCGTCTTTCGCCGCTGGCGACCAAGTTCTCCACAAG
TCAGCGGTACCCGCCCATGCATTCCGCACCCGCGCGGTTGGAATGTCCTCCAACGTCTCCTCAAGGATGCTCCTTGGGTTTGGGATTCCGCTTGTCCGTC
GGCCTTCGAAGGCCTCAAAACCAACCTTCAACGCGCCCCGATCGTGGCGCTCCCAGACTTCGACAAACCTTTCTCCGTCGTCTGTGACGCCTCGCAGTTT
GCCATTGACTGCTGCCTGATGCAGTTCGACGCCTCCGGTCGCCCTCGCCCGGTCTCCTAGCAAAGCCGCCAACTTCACCCGGCTGAGCGGGCGTATCCAG
TTCACGACTTGGAACTTCTCTCCATGAAGTACACTCTAACCAAGTTCCGAATCTACCTCGGCGGTGAACCGTGGTTTACACCCATCATGCGTCCTTACGC
ACGGCGACCAACACACCGCACATTTCGCAGCGCATGGCGCGCGGGATTTCGTTCTTCTTCAAATTCACCTTCTCGGTCCAGTACAAGCCCGGGAAG