Description :
From Genome Similarity Track
Location :
Scaffold_2:167953- 202847
Transcript NameFunction/comments
Phyta_totarag161hypothetical protein
Phyta_totarag162conserved hypothetical protein
Phyta_totarag163hypothetical protein PHYSODRAFT_263020
Phyta_totarag164hypothetical protein PHYSODRAFT_315985
Phyta_totarag165ser/thr kinase
Phyta_totarag166conserved hypothetical protein
Phyta_totarag167hypothetical protein PHYSODRAFT_505989
Phyta_totarag168hypothetical protein PHYSODRAFT_505357
Phyta_totarag169phosphatidylinositol-4-phosphate 5 kinase-like protein
Phyta_totarag170hypothetical protein
Phyta_totarag171hypothetical protein PHYSODRAFT_286394
Phyta_totarag172conserved hypothetical protein
Phyta_totarag173conserved hypothetical protein
Phyta_totarag174conserved hypothetical protein
Phyta_totarag175hypothetical protein PHYSODRAFT_315997

Sequence
34894 bases(100 bases per row)
ACGTGGCCATACTAGGTGGCGCGGTGGCTAATACTTGCTTTAACATGAACAAACGTCACCCGACGGTAGACCGACCATTAATCGATCCGGAGCTGGCATT
GGGGATCCCAGTCGTTATCTGTGGGGCTGTCCTAGGTGCAGTGATCAACAAGCTCATACcgagctacttcgaagtacatgtatatcgTATCCCTACTATT
TGTTGTTATCCTTGCTGTTAGCGGTGCACGTATGAGGCTGCGGGGAATCCGTATTTTCAAGAAAGAGGATGCTCAAAAGAAATtggctgaagctgttgcg
aATGAGGCGAAAGCTGATGTACCAGCAAGTCTAAGTGTCTGCATTCAGGCCAGCACGCCACAACATTCTGGCAGCGACGATATTTTGGAGGAGAAACGCC
TCAGTATCTCAATCAGTGGAGCAGTTGTCTCCAAGTCGATTGAACGTGACGAATTTGGTGCAGCGCCGAGCTAGCACAAATTATCGAAAAGGAACGATAT
TTCGCTTGGGCTCCTCACGGTGCTATCGTGAACTGCTACCTCGGTGTCGTGGCCACGAGTATTGGTGATGCCTCGTTCATTGCAGAGATGTGGCGTACTG
GGTAATTCTGCTGATCGAGATCCCGTGGGTtgctgtcttcgtcgtacTTACGTCACACTATCTACACAAGGTGTACCTGCGCAAGTCTGCATTGAACTAC
CAGTACGTCGAGGGTGGCATCCACTGGACGAAGAAGCCTGTGGTGTATTTCCCTCTAGCTGTGCGTTTGCTGGCATTGTCGCGGGCATGTTTGGTGTGGG
CGGAGGCATCATTACGGGACTTATCATGATTGAGATGGATATCGTGCCTCATCCACAATGGCGCTGATGATCTTGTATGTATTCGTcggctgctgccact
gcaaAGTACACTGTATTCGACATGATCGCGTGGGACTgggcattgctgctgtgtgcgGTAGCCTTCGTGGTCACTTCAGCTTCACAAGTTGTGATCCTGG
GCTTCGTTCGTAGGACGGGTCGTCAGTCCATTTTCATTCTTTGCATCTGTGCTTCCGTGACTATTGGCACAGTGCTAATGACATACGAAGCCATCAAGAA
CACTATCGACGACGCGGGTAATCACTTTTCGGCAGGCATTTGCAGCTAGAGCTCACGAGATCTTTACGTGGCTCAATCATGTTCACTAATAACTGTCCAT
CTGCATGCTGTCTAGTGGTTGTTCATTTACGTCGGAATGGCTCCGTACTTCTGTCGCTCCATGCGGCGTTTGACAACATGACGAATCAAAAGTACAATGA
AGGAGAGCATTAGGATGCCGAACACCGTCCACAGTAGCGTCtcaaatgcagcagctgactTCGGCGGTTGGCTGATGCTATCAGAATTGctgacttcaac
atctcgCACGCGATCCATTGTGATGCTGGTCGTCAGCGCAGAGTTgatgttcagcttcttctcgtggaTTAATGAATCCACAAACGGACGCAGTGTATCA
GCGACGCACACGTGCTTAAGTGTCTGGCCgatcagcttcttgaacttTGAAATGGGACAGCGCACATCCGTAGTTCCATCACCAATACCAACCTCCTCCG
AGCACGACGGGATGATAACTTGCACGCGGTCTGGAGGCTGTTCCACGCAAACACATCCCAAGCCAGGTTAGACgcattggtgctgcagcaaacaacaaGA
ATCTAGCGTTATCTCACGTTTTCTGGGGATAATTCGTCACCGTCGCGAATCTGTTCAGGAGAAGCCGCGACAAAGTATAGCTTTACGTAGAATCGACTTT
CGTCAGCCTCTCTCACGTGCCAAGACACATGCGTCTCACCCATGCCTGCAGATTTTAGCTTCCGGGACTCTGATGTACTGGGTGAAGGTTGCTCGTCGGT
TTTTGCAGATGTGGCGTGAAGCTCGAACACAAGCATGCTCCCTGGTACTGGCTGATGCGGGTGCCATCCCTTCGTATACCACTGCAGCCTATTTCACAGA
GCATTATTAGCATGCAAAAACGTAGCAACGCCCTCGTAAGGCAAGCTTCCAAAACTGAACCGCCAAAGCGTACCTTAGCAGGTTGCGAACATACAGCAAG
TTGATATCATGGGCAGCATAGTACAATAGTCGGTTTTCCGGACCTTGCAAAAGATGGGGGCCCTCACCTTTTGATACGGGCAATGCTTTCTGCATAATAT
TTTGCTCGAAGCTAGCCGTAAGATGGGCGAGCAGGGTCGCACCAAAGCTTTCAGAGTTGACTTCATTGGTAATTAGATCCATGTGAGTCTACATCATTaa
catcagcagcatgttAGTAGCGAACACAGTTGAAGGCGAACGAACACAAACATTGAAGCCCTACCTCGTGGATCTTGGCCAGCGACAAAATTTTCTCGAA
CGATAATTGCGAAGGCAGGCTCATATTGTTGAGACTCTGCAACAGAAGCCACTCGGAGAAATAGTCGGTGTTGGAGAGAGTGTCCTTCCATGGCAGGTAG
AATGCCCCGTTCCACTGCGCGGGAATTCCAAACAGGTCGCACGTCGTGGAACTCTCAGACGAATCGATGTTGACAGGCTCCTCGTCGATTTTGCATACGG
ATGCAGCGCAACACTGGAGAAGTTTGTTAACTTCTGCAACTTCCTCACGGATTTCCTGGAGAACAAATCTCGTGTCGTTGCTTCCGGTAATGCCTTCGTA
CACTGCAAGTCGCAGCACAAATGAACCAGAGATCAGGGACGACGAATATTAGCGGCCGCATCATTCGCCGCTTATTTGCAAATACGCACCAGCTTTAGAG
CACACAGGACAATTAGCGGTAGGGTCTTGGCCCTGCTCGAACAGCAACTGGGTTCGTTTGGTGATTGGCACGAGTTCCTTGCACGACGGATAAACCCCAC
TCAAGAACGCGACCGCTGTCAACTGAACGCAGCAAGGTGAAAGCATAGCACCAGAAGCATTAGCCTAACGTATATCGAACATCACTATACACGATACGTA
CATTGTCTCGCTGGTTATTATCAGCGTAGGCAAAGGTTTCTTCGCATGTGGCGTTCAAAAAATCATTGTAGAGGTGGTCTCGAAAGTACTACGTGAAAGA
GATTTTCGTAAAAGTTAGGTCAGTCCACATGAAATTCACGCACTGGTAGCACGTTCCAACGACATTGCACAAGCTTGTATACCTCCCCCATGCGCTCCAC
GACGCGGAAGCCGTGTTTCGTGAGCTTGGGCGATACGACCTCTGTCGGTTCTCCAGTCTCCGACGTGCCCCACGCGTTGGCACTCAGCGGCAGATCGAGG
TTCGGGTTGCGCACgtactgcttcagcagctcctccgaCGGGGTCTCCGTGCCCAGTCCGTAGGGGCCGCGCACCCCGTGACGAGACAGCACGATGACCT
ACGGTAGATGACTGCGATGAGATCGAGGCCGATAGACGCGCGCCATGTATTTTACCGAAGCTTTCAGTGGCCGGGAAGGCAGTATCGAAAACGTACCTGA
CGCAGCCCCGACTCGGGCGTATCTAACGCTGCGTCCGCGAGCGCTATCGCACCGAGCGCAAAGAGCGCAGTAACTCTGCCTAATGTCATCGTCAGATTCT
CAGAGACTTGGTTCATTTCGAGCGGCAGTACTGTGTCGATGCGGCTAAGTACGTATGTGAGGTGGTCCACTCTGTATCCCCTTCTCAACTCGTTCAGTGG
GTGCCGCATCGGTTTTGAGGGTAGATTCAATACCCATGCAATTCGGCTCCTGCCAGGAAGCGCCAACTGGCCATTCACGATTGCTCGCAGCGATCCTTTG
GCCCCGCCGCGCCGTGCAGGGTAAACTTGATCAGCACCACCTGATTTGGCTGCACCGACCCAGCTGCTCGCTCCACCCACACGTGCCGATTTCAGCCTGT
GGAGTGCGGAGACGGCAACTTGAGCTGGTATCTGAGCTCAACAAGCACATGTGTCGAGAAACTTGGTGGCGACCGCACGCGCGCCGCCGCAAAATAATGT
TATCGCGCTTCATCGACAAATACTTTGTGGACCTGCTGCTAGACAATGCAGCTATAATGAGAAGTACATGGCCTCAATTGCGCTGCAAGAGCTGGCGATA
CACAATGGGGCGAGCGAGTCAACGTGGCGTGGCGCCGGTGCCTTGCTCACGCGTTTCCGATACAAAAAAAGTTTGACCGTTAGTGCTGTGAGATCTGCCG
TGGATTGTTGGGCACCGTTACGGCTGTGCGCACTGTCCAAGCAAGAGGCATTTCGTTTCACGCGCGACTTGACATGTGAGCCCAGCCCGCAGCACACTCC
CGGAAGATGACCAAGCCGGGCTCCGTACATCGCGCGCATGCGATGGTGCACCAGCGATAGCCACACGGACCGGCGGAGACCTCCGGTTCCTTGACTCGCC
CGTCCACAGACTCAAGAGCGTACCTGCGACGACTGTGCTCCGCTAGCGCGAGCACCGCGTGTGTGGTGGCTAAGTTCGATATGGCCTCCAAGCATTTGCC
CAAGAACATCTTCTTGGCAGGAATGCGGCGGGATCAGCTCCGGGTTGCAGCTGTTTCTCGTGATTTCACGTGAGACCTGGGCTGCCGGCGCAGAACCATC
AGAAAGGTGGCACACAGTCCTTCTCTGCTCAGCGCGGCTTCCGAGACCACCGAGCCCTGCTCACTCACAGTCAAACACCTGGCTgccgcggcggcggcgg
ccacatgtgctgctcgagcttaTTAGCAGACCTCGTCCAGTCCAACCCGTGAGTGCCTCGCGACTTTCCCGGAAACCAAGCTGGGCCCAGCATGGCTCCG
CAGAACCCACTGCACTGCGCTGCCCCGTGTCTTACGCCCGCAATCCCAGGCGCGGTTTTTGCTCGCGACGGCCGTTCCAGTTTGTCGCGGGGTCGCCGGG
GGCCCACAAACACTGCCCGAACCGCAGCTCGGCCACTTGGTCGGACCGGCTGAGCAGAGGTGCACTGCCCCCGCTGCTCTCTGAATAGAGTGACTGCTGA
AACGAAAGGTGGGTCGGCCGGCCGGCCGGTCTCTCCCGACCATGGCACTTTATATTTGACGTCGAGCGCCACACTCGGAGGGATACAGTCCTATACGCTC
GAGCACTACATTAGACTACTTCATCAGACCGACATGACGTCCTGCGTGGTGCAAGTTCAGGAGCTGTCGCGCCGCCTGCTCAAGCGCCTGCGGCCGTCAC
TGCCGGCCAGCGCCGGCGTGGAGGACCTGGGCGCCGCTCGAGACTCGGCAACCAGCGAGGCGCTACTCAAAGTGTGCAAGCGCCAGATCGAGTCGTCGCC
GCGTTCGTCGGCGCAGGCGATGATGCTGGCCGTCGAGCCGCTACAGGAAGAGATCGTGGCGGCCACGCCCGTgagcgacgccgccgccgccgccgcgcaG
TGGCCCAGCGTCACCGGATGCGAGGGTGTGCGCAAGGCGCTCACGTTCCTGCAGACCTCgcgccagcacgcgctcATGCTCATGCTGCAGAACCACTGGG
AGCGCGCCATGAGCGTGTtggagaagatcgagaaAGCCACCGAGAGCGTCAgcgagcagcggcgacaagtCGTCATCCAGCAGGCCAACGCCGGCCGCAA
CCTGCTTGTCGAGAAGAttcaggagctggagctcgcggCGCCGCGCCGCACCGTGCGCTTCAGTGACGAAGTGGCCGTTGCCTTCGCGGAGGACATGGAC
CGCAAGTGCGAAGCAGTGTCGGAGCCCGTGCGCGAAGAGATGCTCGTCCTGCACGCGTCGCGCAAGATCCCACAGGAGAACCTCTCGGAGTTCTGGAACG
AGTAAATCCACGGTCGAAACGGTTGCCCACAGGGTCAATGCATTGGACTCGTGCGATAACTTATTTAGCGGATCGGGGCCGATCGCTAGGCTCCCGCCGA
CAGACGCAAGCAAGACAAGACTCCTAACTTATTCGGCATAGAACCTATTTAATACCATACACTAGAACTTCATTTTGTCGTAGTGTTCACTGCATATACT
GGTATTTGGTTGCATCCAAGCCACCCTTCCACAAAGGTTGGGTGGGAATTCCTCTCGCCCCAACTTCGAGGCGTATCCGTAGCCTACGGACCGTAGGCCA
CCGCCCTCAGCGTTTCGGTGTCGTTAGCCAGGGCGGAATGGCTGTTCGTTCCACCCCCCCCCACCATCTCTGGATGGGATGCGGTAGCCGCTCTCGCTTG
GATCGGCGTTCATTTTGCCGCACGAAGTGAAGGTTCGGTTCCACGCACTTGTCCGCCCTGCGCACGAGAGTTCGACAACTTGCACATGAACGGCAAGACG
TTGAAGAACTTTCGGCAAAATTTGTGCTCAAATCGCCAGCTCGCGCGTGACTTCGCCTAAAACCACTCGGGTTGTGTTCTCGCCGCCACGAGAGCCCTCG
ACCCTCTGGAAATGTGGAAAGCGGCTCAGCTCTGCTAGGGTCCTGTGAAATGACAACCTCCGGCCTAGAAAGTGGGCAGCTACCGCACGCTCcataattt
aaaaaaaaactgacCTGATTAAAGAAAGATACTTATGCTTGAGAATCGCTATCTTGCCACCCTACGACTGTCAACCGCAACAGTCGATCGAACACTCCGA
AAGGTTTTGCCTTCAAGTGGTGGCTCCATGTCGCCACAGTTGACCAAAGCCCTCACCTCACATGAATGGATTTGTAGACGATGTTGATAGGCTGTTGTTG
GAAAATACAAAACAAAATAATAGAATCGGGTTGCATACAAACGCCAATATAAAAACTGGCACCCCTTAAACTCGTTCCGCCGTAGGTATCAATCATTCAG
ACCCCCCTCCAAGACAGTGCAAGCGAGCCCCGCCCGTTGCATGATGGCCGACGCGACGCTGTACCGCACCGCCGGCCACCCGGAGAAGGTCCGGCTGGTC
TTCAACgcgcagctgcaccagcagctcaagaacatCGCCAAGAACCGCGAGATCTCGGCCGTGCCGGGAGCCCccaccatctccagcaaTGGCAGCATGC
GCCCCACGCAGCCGATGGTGCTCAACGGGGCCGGTCGCTCCACGGAGTTGAACGGCTGGAGCCTagagaagaagatgctggcgctggctgaGGCGCTGGA
CCTACTGCGGCGcccgttcttcttctacttGGACTTCGGCACGGCCGCGGCGGCCGAAGCGTCCAATGGAGGCAGCGCCGGAGCCTCCGGGGACCGCAAA
CTCACCTACCACTCGTACTTTAACAAGATGCTGCCGCTACACGTGGGCCAGACTGTGCTGCTCGACTTGTGGTACGTGAAATGACGCGGAATTTGGAGTT
CTGGAGCGTGTTTTGACGGATTTTTGTGCTGTTGACATGTTAGGGACTATTTGATGGATATGGTCGACCACGTGCCTGTGCGCAATCGCTGTCGGGCTCT
GTACATGCAGGCGGCGGTGTATATCTGCCGTCGTGTTGAGTTTATCGAGGGGTATCCACTGGACGGACAGCAGGTACATCTGGACTCGCTCGTGGCGAAG
CGGTACATTCGTTTGTTGGACCGGAGCGTGCGCTTCTGCTCGGTCAAGATCCGGAAGGCTCGCTTCATGGCAGAAGAGCACCGATTTTTTGTGGCTCATA
TTTACACGGCGGTGTATTTCCGCTTCCCTTTTGCCAcgcccaagctgctggaagctgtaCTGCAGTGCACGGAAAAACTTGAGGGAGCGGGGGAAGCTGG
TGGTAAACAAGGTGCGAGTAACGGAACAAGCAATGGGTCGAATAAAAATCTGAACGGGATGAAGAATGGTGATCGCCCTCCCAAGACGAAGCATCGGCGG
CCTGCGCATCGTGGAAGTATCGCCGGCAGCTTGCGCAGTCCTCGACAGTATCGCCGCCAGTGGAATGATCTTTCAGGTAACGTAATCGACGGAAACTGCG
CGTTTTTAGGCTAGTATAGTAGTAAGGTGACTGACCTTAACTTGTTTTGGCTGCCTGGTATTGTAGAATCCAAATGTCGGCCGGATCGCATCAGTGGTGT
CGACTTGCAGCTCGAAATCTTCTCGTCATTTTCGGAATACAAGTCGAACCGCGGTACAGATCGACTGGTGGTGCCCGTGAAGGGTGGCAGCACCCCGGGT
ATTCCGCAGGATATGTTGAAAAGGGGTTCCAGTAACAAATCCATTGCCGCCGCTCTAGAAGCTGTGTTTCAGCAGGGCATGAACCGCGTCGGTGAGGAGC
AAGAAGTGGCCTTTATTTATCAGCTTCCGTTGCTGTATATTGgccacaagctgcagaaTGACGCGTTTGTGAAGCTGGCGGCGACAACTCAAGACAAGAT
TGAAGCAGGACTGGACTTATTCATTGAACGGGTGAAATCACCGGGGAGGGATGACCTCATGGCTGTGACCTTCGTGGCCGCCGTGCTGAGTGATGTGAGT
TGTTGGTGCAACCATCGCTACGCAGATGGTCGCATTCTGTGGCATTGTGTGCCCGGCTATTTTGCACTCGTTCGCCTGTATGTGGCAGTTTTCGAGCGCA
TGTGTCAACGGCGTGTGCGGTCTACTACGGGTGTTTCGTCCTTGCCTTCAGTGAATCGCATTCTATCCATTATTGAGGGCAATACAAGCGATCCATGGGA
AGACTATTGGAATGATCGCGAAATCGATACTGTGCTGGACGCAGGCAGCGAGGTGCTGAAAAACGAGGCGCTGGTGAATGTGCTCATGCAGGTCATCCTG
GAGAGCACCAACATCCTTGATCCTACGAGCGTCAACTACTCGTTTGGCATCTTGCAACGAATGCTTGAAATCGCCTCGATGGCTGCAATGCCTGCTGCAA
CGGAAGCTGGGTCGCTCCCTGAGACGTTTGGCGGTCGTGTCCGTCACTGCCTAGGAGCGGTATTTGATGGAGACTACTTTTTGAGCAGCATGCGCAGCGC
TCTGCAGTCATCACATGTGCAAACGCTGCTGAAAGTCCTCACGTGTATTTACAACTGCATCGGTAAGGATACTGATCGATTCCTACCTTGATAAGGCTGA
TTGACTGACAGTGATAATTTGTACTTATTTGACAGACTTGTTGCCAACCGTTGCCCGCAAGCGGCTTGTCGCGGAGCTGATCCTACGCGAAAATTTCTTC
CATTTCTTTCTGCATTGGAACGAAGAGGTAAGTCAAATTGCTGGTTGGATAGTTTATCGTGTGCGCTACTCACACGTGTTGTTATTGTGTTGGCAGATTC
GGAAGATCTTCTGCTACATGATCGTGTTTAAGACCTCGGCTTCGAACCGGTTAGACCTACCCAGTGCATCCGACCGGATTCTGCTCGCCCAGACCCCATT
TTTCGAGGTCGGCCCGACATCCAGATCCAACGGTTCAAGTTTGTCAGCTGCATCGCCTGCACTCAGTTACTTGAGCCACCTGAGCGAGTTGGCCCAGGCC
ATGTTGCGCCCCACTGCTGACAGCGAGATGGATCCAGCGAAGAAAGCAGCCGTTGGCAAGAAGGCGCTCCAACGTCTCACGAACTGGGATTCAAGCGCAC
GGTTGAAACGCACTCGCAGTGGCGGTGATGCCGTGTTTCGAGACAGCCTCGTTGACGAGGAATTATCCGTGGATCTTTCTATCGCAAGCAAGCTTGATGC
GAATTTCAAAATGATTGCCGAGCAAATGAATCCGGCTAAACATCAGTTTGCGCCTGTTAAACGGTACTTCCCCCGGGAGCTGGAGGCTTACGCTGAGCGC
GCGCTATCGCAATACGTTTTGGTGCTATGGGAGTATTACGAAGCTGCCTTCGAGAACCCGGCGAAGATGCCGATCGCACCGTCACTCGAGTTCACGATTT
CCGTGCCATTCTTTTCCGACTAATCCGACAAATGAGTATTACTACTGTAGTTTGTAGACGTATGCTAGGCCTGATACGCTAGTGTGCGGGACCCAGTTAG
ACTTGAGCGTAGAGGCTTAGCTGGCGGAACATTtccttgctgctgtagaCCGTAGTGGTCGCCCCCGCTAAGACAAATAGAAGCAAATACGTCAGTTGCC
AAAGCGTAAGCCGCTCAAAACAAATGCCACATTTCCTCACCATGCAGTGGCTCCGTCGTGAACATACGCAAGTCCCCTGCGCGTACGCGCTTCCAGTCAC
GTTTTCGACGTGCAAACAAATTATCGTGCTCCTTTTTATCTGCCGTGCGACCTGTTATGAGGCGAAAGCACAGGAATGGGCTTAGTTGACAAACACGAGC
AAGTTCAACGCAGGCAACTAACTCACTTGGGCGATCCTGTTTGCGCTTGTGTGTAGTCCGGCAAGAATTTATCTGCAAGTAATAAAATAAGTATAAGTAC
AACGAAGGCTTCCAAGAGACAAGAAAATCAGAAGCCGAAGCACAGACCGCGGCGTTAATCTGCAGAAGTCTCTGGCGTTCCTCGCGATCCAGCGTGTGTT
CAACGAACGCTCTCAGCCACCACTACAATGAACCAACCACATGAGCAAAACAACCGTCACAACTTGCATCGCCCTCTATCAGCACGCACCCTTGCATCCA
TGTTACGCAGCGAgtgcttcttcgtgtgcaCGTAAGTCTCAAGGAACGAATCATCACGCAGTTGTTCGCGATGCCCATTCTTGATGCAGTTGAGTACAAA
TTCCCGCAACGGTTTGTAAGCTCCTTTCTCCAGGTCCGGAcactcgtgcagctccatgaactcgaaCACCTGCGTCTTGAGCAGGAGCGGCGCTAAATCA
TCTGCTAGTCCTCCCTCCACAGTCACACACATCGTGTGGACTCCAGCGTTCTCGAGTCGAATGTCCTGCACGTAATAGACGCCATTGGGGAAGGCGGTTC
CCACTCTCTCGTTGAACACCACCTTGTCCTCGTTCTGGATGGTCACGCGCAACGCCGCCACCGCGCGAGACTTGACGACCGTCGACTTGCCGTTCTTGGT
GCACGCCACATAGAAacccaagaagctgcacagGCAGAGAACGAGGCGATGTATTAGAGAGGATTTTATGACACAGTGGAGGAACGAGACGCTTGCTACG
CACCGGAAGAGCGAGAATTGGAGCGGCACGCgctctggcagcagctccgcccACTTGTCCGCGATGGGGAAAAGCTGGTAGCCGTCTGGGAGTGACGGGT
TGCGCTTGATGGTGATCGGCTTGAGATTCTTGAGCGACATGGCTTCGACACCAACTCGGACTTTTGAAATTGTCTATCCAAATGTCAAGTTTTCGCGCGG
GCGGGAAAGTGCGCTTTGGCAGGTTAAAGAGCATTTTCGGGTGGACCACACTTTATTTTTAAATAAAAAGAAAGTATGATTGGAGAGCATTTTTGAGATA
TTTCTATTTCTAAAAACTCAATTTTATATCATAATCGCTGAGGTATGAGCGGCACTGGAGCTCGTCGCTGGAACATCGCAGAGACGCATTGCATGGTGAA
GCggaagacggagacgggTGACAAGTTCGTGAACAACTACCGCCTGCTGCATGCACTGGGTCAGGGCCGTTTCGGCAAGGTGAAGCTCTGCGAGAGGCTC
GCGAACCGCGGAACTCCAAGTTCTACTTCTACCAACGGCGTTGGTGCTGTAAATGCTGATTCTGTTGCTGTTAACGACGATGCTGGTGTTGCCGTTGCGT
CACTACCCCCTCCAGCATTTGCACCGCTCAAGGCGCGGCTGTTTGCGATGAAAATTTTCtccaagaagatgctgcgccGACTCAAGGACTACTGCGCAGA
GCCTGAAGTGGTGCAGTGTGGAGGGggaggagatgaagatgctgatgtTGGGGAAGATGCGGTGCCTATGAGGATGCGGGTAGTGACGGCACTGGACCGC
GTgcacgacgagatcgagatcaTGCGCTCGCTGTACCATCGCAacattgtgctgctgttcgaagTCATCGAGgcggacgacagcgacaaaCTCTACATGG
TGCTTGAATACATGGCGTGTGGTCCATGTATGGTCTATCGACCGGATACGAAGGACTTTCACAGCTGCGTCACGGGTAGTACATTGCCCGAGGAGCTGGC
ACGGAGCTACTTGTCGGACATCCTGCTTGGTCTGCAGTACTTGCATCAACGCCGAATTTGCCATCGCGACATCAAAGTGAGTGATAAAATGCAGTCTTTG
TGGGTTTGCTTGACATCATTTTGCGTGTTTTAATTAAATGCTGATCGCGTGGGTGTGTTTTATTTTATTTGACGAACTTAGCCCGACAACGTGCTACTGA
ACGACTCGGGACGCTGCCACATTACTGATTTTGGCTGTGCAAAAGCATTTGGTAATGTCACTAAGGATGGTGTGACAGGGGCAACAGAGAACGGTGCCGA
ACCAATTCTGCTGTCGGACACAGTAGGAACCTACCAGTTCTTGGCGCCAGAGTGTTGTTCCGGTGAACCCTACGACCCATTCAAGGTGGACGTCTGGGCA
GTCGGCGTGGttttcttcattttcctGTTCGGTAGACTGCCATTTACGTCCGAGAGCACGCGAGAACTCTTTGATGAGATCATTCGCGCGGAGATTATGC
TGCCTGGTTCAGAAAAGTCGGGTCGAACGCTACCACTCTGTCACGAGGGCGAAGACTTGCTGCGTCGACTGCTAGAGAAGGACCCGGAGCAGCGGATTAC
GATCGCCGAAGCCCTTAGCCATCCATGGTTCGTACAAGATGAGGATGGCGAAGAGCCTCTTTCGTTCTGATAAGTGCCAGAAACCAGATAATTTCTGGTG
TTATGTGTCAAAATCATGTCGGTTCTTGCAACACAAGGAGACTGCGTCAGGTTGTGGCCATAACTGTGCTGGGTTTGAAGTAAATTGTGTTGAGCTGGGC
GGAACTTCCTTCCTCGTGGGTATTAACGACAGCAGAATAATCCGGAAATGAAGCTATCGTTTTAAGGCTTCCACGTTGGCGTCCTGACGCTAGAACGTCG
TAAAACCAAGACTCCATTTCTCAATTTGTCAAGCCAGACGCAGAACCACGCGCACATGCATCTATTCAACACCCGGTTTGATCGCTTACTCGTTCGAGCC
GGCTTGAAGAAGTCCAAACACTCGAGAAGACGAGCTGCATCAAGAACACCCGGTCCGACGGTAAGGACAAGATGGAGGGTACAAATTCAACCTGCTCACC
GCTCGCGGACAAACAACCATCGCTCGATGCAAAGGGAAGACTGGTTGATACCTCGACACGAGGTTCAAATGGACCTCGAACCGTTTCGTGTAGGGGCATT
CGGCAAGATTTACCACGGCACGTGGCTCGGGTCCCGCGTCGTCAAGTGCGTCGATTTGAAGTCCACTAAAAATCGCTGTGCCTTTTTGCGGGAAGCAGAG
ATTTGGAAAAACCTGCACCACCCGCATATTGTCCTGCTGTATGGTGCGTGCCTCATGTTCGGGGAGCAAACAGACCAGCCGGGGCTCTTTATATGTGAGG
AGGCTGATAACGGCAGTTTGCGAGACTTTCTGTTCAACGAGAGACAAGCAAGTAGATCACCACCAGTGTGGCGAGCTCTTCGCGACGCAGCGTTGGGACT
ACGTTTCCTGCACCAGAGAGGAATTGTCCACGGAGACCTCAAAGGAAACAACATTGTTGTGAGCAAGTCTGGAGTCGCAAAACTGACGGACTTCGGGCTC
AGTTCCATTCCAGATCGAGAAATATTGTCCAGCAATCCTTGCGAAGCAATCGGCGCCAGAGCTGTTCGGGACTAACTGCAGCGCTCCTACGTTCGAGTCG
GACGTGTATGCTTTGGGTATGTGCATTGTTGAGGCTTTGCGTGGCGGATCGCCGTGGGGAGCGTAACCTGACCCCGCTATTCGGTACAGCTTCATGAAAA
TCAAGCAAGccacagcagaagcagattTTCGAAGGACGATGTCTCGGGTCCTACCGAGACTTGTAAACGTTAAAAATGACCAGCACTGGCTTTTcgtgaa
gcagctctgcGCTTTCGAGGCCTCCGAGCGACTGAAGCTCCCGGACGTGATCAGAATCCTCGAGCAATTTGCTCAAGACGAAGCCACACAAGAGTTTTCT
CGAATGCACTCCTCGCTGGGATAGCACGCTACGTTTATTGAGAAGCACGACTCTGCCTTTTTGCCATTCGCTAACATCAATGTAAAATACACACCGTCTA
CTTTTACGAACGATCCTCGACTCGCTCGGTGTGCTGAGCTTTCTCGTTGTAGCATTCGTCCAGCATTTGGTGAGTCAGCTGGAATACCTCGCGGACATGA
ACACCATCCATacctccaccagcaaacGGGTCCTCCATCGTCCTctcgacgttgaagatgcCTGTCATCAGCAAACTCGTTGACACACTAAGCAGCAAAC
AAAAGGCGAAGTTCGTGGCTTGGTACTGGTTTCCTCGCGCAATATAGACGTAGTACGGCCCATAGAATAACGGGAgcacgaggatgaagagtCGGGTGAA
CGAGCGAGTAGCTTGAGGCGTTCGGTAGAACTGTAGTAACAAAAGAAAGTCATCAGCATCCAGAGCGCAGAATACTAGGCGAACTGAAGCCCCTACCTTG
ATGTTCTGGAGCTACTCGATGCGAGCCTGGAGCAGCCAATGGTACTGATTAATCCGCGAAGCTTCATTTGCAGGCATGCCACAGGCTTTCAAGACCTCTA
CTTGGCCGTGCAATTGACGAATCGTGTTCACGATCTGTAGCTGCAAGTGTTTGACTGGGGTTACATATTGCGAAGCAAGTTTCAGACCGTGCGAAGTAAA
TCTGTGTCGTCCACGCGTCATTGTGGGCATGACAAGTAGCGACGTCGTGTCATGCAGCAAAGCTTCCAGCAACATCTTGGTCCTGCACATGATCCTGCGG
CAATTGTCTCCGTCCGTTGCTTCCCCAGTTCCACAACGCATTGGCTAACAATATATTAACCAGCAAGGACCTCGCTACGAACATCACAATGGTAAGCACC
TAACCCAACAATCACTTCACACAAGACACCGCCTTACACTCTGCGATGATGTCCAGAGCTTGCTCTCGCCGTGTGAAGGCTTGTCTGATCTGCATGATCA
TTGGCGACACCACTGCGAAGGACACGATGGTCCACGAGATGTTGGCACCAAAATTCGGGCCCGAGCTGCTCTCCCCCAGGTAGTAGTAGAGCGAGGTGGT
GACCACGGAGAAGAGCACCACGAACAGGCCTTCGAACGTGATGAGATGCAGCCCAAACACCTTCGAGGCAGCGTACAAATCCAGCACCGTGTCACGAAAA
CCCTCACTGGGCCGTCGCAGCGCCGCACTCATCGTCCTTTCGTTGTCGTCGCCACTGCTTCCCCTCAAGTCGACGAAGTCTTCAtgtcgacgtggagaac
TGGAGGCCACATAATTGCCACGTTCCATTGATGGCCGCTTGTCAAAAAATCTCGCTGATTGAATTGCGTTGACGTACAGTATACCCATGATAATATATAA
CCGGTACAATCATATCCGATGCAGAAAATAACGTGCTTTGAATTACAAAGTGAAACAATATCCAAAACTAATTTACCTGTTATAACTAGTCGTATCAGAT
TCATCGACGGAGATTAACATGCTATTTCACTTCAGTGACCACCAGCCATTCGACAATGACGCAGGTTGCGCTCAAAGCGAGGGTCTTGGATGGTGCCGTT
GTTGGGATTGAAGAGTTCGTGGACAACCGCGAGGAACGCTTGGTTGTGCGTGGTTGCATTAAGACGAAGTACGTGGTGGTAGTAATGACAAAGAGGTTGG
GATGTTGTactgaagcagctgatgTTTCAGGCCTGAGGACTTCGTAGTGCGCGAGATCAGTGCAACCGGTAAAGTAGTGGGTTTCAGTGATGAGAGGGAC
CGCCTTCCAATGGGAAGCGAGCGCGACGCTgtgctgaagatgctcgaagcgacgcagcaggaggagaagaaggagaggcTCGAGTTTGATGAACCTGCAG
ACGGTTGGCGATCAGCGTTGACGGAGCTGATTGGAGCTAAAGACGTTGAAGGTGTTGAGAGCGTGGCGAGAGGCCAAACTGAGGAGTGCTTTCTTGCCTC
ACCCATGGAATTTCGGGAGCGTGTGTATCTTCAAGTTTGCATCCAGGTATGCAACGCAGCTCTTCGTTTGGCTTTCGGTTGGAAACTAAGTTTACTGGCA
TGACTTTAGAATTGCTTCCCAGGACTGGActgcaagatgcagaaggcGTTAGCATCGGAAGAGCATGGGGTGCAGCAGATTCAAGTGTTGTTGGACCCTG
TTTACAAGAAATTTCGAGAGGGAGGAATGGCGTTGGAGAATTGCGATCGTCTACTTACATTTCTTCGAAACGGAGCGAGTGACCCCACGGCATCGAAAGG
TACCAACCAATTAGGACTTTACTGGTCTTATTGTGGTTGAGACTGACTGCTGACAATAATGTGTACTTGAGTACAggactcgagctcgagcacgATGACA
CGAAGGAAGCTCGAACAACGCTGCATCGCTTGATTGCCAAGAACTCGTCGTGCTTTAAAACGAAGACGGAAACCCGAAATGGGGTGCAGCGCCTGGTTGT
GCACTTCCTACCAAAAAGCAATAAAAAGCGTAAGCGCTCTCAGCCGCAAATCTATCTGCGGTTTGTGCTCCAAAAGGTGAGCTTGTCGTGATCTTTGCCG
TACCCCCTCTTTAACTTCTATCTAACCCACGATTTCTTGGATGTGCCGTAGACAAACCAAGAGCATTTTGCAGCTTTCGACAAGTTAGCTCGGAGGCTTC
GCCGCCCGCTCTCCGCATTTTCATGTGCAGGCACAAAAGATAAGGCAGCCATCACATTCCAACACGTCGTGGTCAGTGGAGTAGAGCCTGATCGGCTTTT
AAAAGTCAACAGTACTGAAGGTGATGCGGCAACAGGAATTCGAGTGGGGGATTTCACATACATCGAAACTCCGATGGCTTTAGGTGGAGCGAATGGAAAC
AGGTTCTCGATAGTGGTCCGAGGTCTTTCTTCCGTGACGCAGTGCACTGCAGAGATTATTCGATCGACACTCGAGTCCACACTGAACGATATCAAGCGTC
AGGGCTTCACCAATTACTTTGGCTTCCAGCGCGTTGGCTTGCCAACGAGCACAGTAAGGACTCACCATATTGGTGAGAAAATGATTGCTAGCAAATGGGA
AGAAGCTCTGAGACTTATCTTGGCGGTTCAAGACGGTGATTCCGAGGATGCTGCCAAAGCAAAACAGCTTTATCTCGAGTCgggcgaagttgaagctgct
ctcAAGCTCATGCCACTCAGTATGTCGGTCGAACGACAAGTGCTTCAGGGATTAAAGCGGTATGGAGGCGACGCATTTGAGCAGGCGGTTCAGAGCGTGC
CGTTCTCACGTCGCGTGATGTACATGCACGCGTATCAGAGTTATCTTTTCAATCGGATGGCGTCGTTCCGGCTGCGTCGATACGGAACCAAGGTTGTGGA
AGGTGATCTAATCCAGTGCGGTGCCCAAAGTGAGAAAGCAGTGAAGGCAGTCACTGCTAACGAAGCTGATGAGCTGAACAATACTCGCCAGCGTGCGTTG
GGGCTCGTCCTTCTACCGCTAGCTGGAACAAGCGTTATGCTTCCATCCAACGCGACTAAGGACGCATGCGTCAAGGTTAGCCCTTGTTATCAAGCATGTG
CACGGAGTGTGAAGTGGACTGAATGCGTTGTGCTGTTCTGCGCTCTACAGATGATAGAGCAAGATGGCACGAAAGATGCTCTCTTCGAGTCCGGACCCGT
AAAAGGCGCCTACAGATCTCTGGTCGCGTACCCGCATGACCTGGAGTGGGTTTGGCAACAAGACCAAGACAATTGTGCGTGCAGTTTTCTTGTCATTGCT
CTGGCATGACTTACGCACTGACTCGTGCCCTCCGTCTACTGTGCTTTTCGTTTGCAGCGCTCTCACTCCAGCTCTCGTTCTCACTCGACAGTGGATGCTT
TGCTACCATGTGCCTACGTGAGGTGCTTCATTCAGACATCTAGCAGCACTGAAAATCAACGCGAATGAATACATGTCATTGGAGTCAAGCAGTCGATTCA
TTAATCTGCCCGGCCGTACCGGTACATTGTCATTCTTCGGAACAGACAACATCTATTTCTTGGTGTCTTCCAGCGCTTGGCGCACGAGCTTAGCGCCCGT
GACCATGAAGAGCGTCTGCCAGATGCCCAGACCCAGACGGGGTACGATGCCCTTGAAGAGGCCACCATAGCCCTGCTCCTTGATGACAGTGCGGAAGACC
TGCATCATGTTCTGCTTGGGCTCACCACGGTCCGCGGCGCTCTGCATCTGGATGCGTGCCACCTCGAAGGGGTGGTTCCAGCAGGACAAGCCCCCGCCCA
CAATACCGGCGCCAGCTTCCTGAGCCACCGTGAGCTTGGCGTCCTTGTCGCCGTGGAACAGCACCTTAAACTGGCCACGCACGATCTCCGTGAAGCCCTG
ACGGGACGCCCAGTTAGTGGCCTGACGGAAGGCGATAGCAGTACCGCCAGGGTAGAAGCCCTTGAGCCCGTGAGCACCGTACACGTTGTGAATGCGCTGc
atggtggagatggagcgaTCGCCCGTCACAGCGCCCGTGACCAGGAAAGTGCAGGGGCCCATGACCACAACCTGGcacacgccgccgccggcacCAGCCA
GGAAGCCCGTGGCGGTCTTGCCCACGCccgcagacagcagcgagtcggAGATGGCCTCCTtggagaagagcaggatGGCGCCCTTGGACGCCGACTCGAC
CATCTTGGGGCCCGTCCCGGCCCAGAAGGCGGAGACGCCTCCGCCCTCGCGCATCACGTTGCGGAAGGCCTGGAGTGTCGTCTCCGAGCGGTAGCGGCCC
ATGCGCGTTTTCCAGACCTCGAAGGGCATGCCCAGCGTCGCGGCCTccagacactgcagcaggccGCCGTTGAACAGGTCGCGCGCACCCACTTTCTTGC
CGGACGCAGGCGGGGGAGACATCTTGGAGCGAGTGAAGGAACGGGTGCAGGCGGCAAATTGAGATGTGACGGAGAAACTGAGTCGCCTAGCTGGGGGACC
AATCTTCGCGAGAGCCGAGCCAACACGATTTTGGTTCAACTTTGGTGAAGTTGATGTCCTTAGCGGCAAATACATTTCTTGTGGATAGTTAGAATATCTC
GTACACGGTACTGAGATACGTCGATCATTGACTACACACTTGGCTTTGTGACGTCACGTTATCGACACCCCAGAATATCCGAGGACGTCAACGCATTTGC
CTTTTGCCTGACAACATCTGCATCGCCACCATGTCACGGCAACGCGGGTTCGTCACTGTAACATCTTCGTGGCACGAGGTCGCCGCGCACCAAGGACCTC
AGCTGATTCAATAGCCGGAGGAAAAGTTGGCGAGGCGAGCTGCATGCCTTATGCGTTCGTGGTCGAATGGAAGCGACCTTCGCACGAAAGAGTATCACAG
CATGAGTATGTTGGAATTACATGGTAACTGCAGCACTTCTCGCAGTATCTATTGTCTTCCAGGTTTCAATTGGAGACTGGCCCTCCACAGCTCTGCGGAA
CTCGACATCGTCAGTGGCCCGAATGGCTTCAATTAGGAGCCTTTGGGCAATTCCACAGCACTTGTCAGGTATCCATTTGAAGGTGCTTCGCCCTGCAACT
TTTTTTGCTAAAGCCGATGCCAGAGCGTATCAAGCTGATTGCTTTTGCGGCGTTGTTCGCGGGTTGATGGTGCCAGTCTCCCATGGATAAAGTCGatcat
cgagcagcaaccGAGCCACCCGCTTCTTTCGCCTTGTGCCGCGTGAGACGCTTTGGCCAgactcgctgcagcaacaggtgTCCGTCCATACATGCACTGA
TACGCACACCTACACTGCACACCAGTGACCACGCTTCGAGGCTGACAGCGAGCCGTCTCCTGCCCTGATGGTATTCAGAATAGCTGACTCGCGCTTCGTT
GGATGCCTAGATGGAGGCCTCGCCTGCATCTCTTCGCAGTACTGCTCATGCTGTTTATCGGAGTCTAGCGATAATTTATCGCTAGACTCCAACGAAGGTG
GCCAACTGCAAAGGCTCGAACGTGAACGTTGCGCCAAAATGCCATGTTGAAACTTGAAACTTGAAAATCCAGTCCAAGAGAAGAGTCAGTTACATACCTC
AAAAATGGTTGGTACTTTCGGCTTTCAGCTtgacttggcgtttgtaGTATAAGTACCAACCGATCGTCAAAACCTCTCccatagtgaaaccaagaTTATA
TGGCGGGAGGGTCGACGCACGACACAAAGGAAAGGCAAGCAGAAAAGTCGGTGCAACGAGTCAGTTATATCGCGGACGTGGTGAGCCCCACGCCACTTCG
ATTCGCACCGAGAGCTTCCAGTCGTCGCGCCGagcttcgcagcagcatttaCTAGGCGACACCAGGCgccacccacccacccacccacgTGCCAGCCAGC
TGCTAGAGACGGAGACGCGATTCCCGTCGTGCCCTGCTGTTTCCCGTGCATCATTAGGGATCGCCCCTTCTTTCCCGTCATAGGACTTGGAGAGGCGAGT
TTAGTTAGCGATAGACAGCGCACCGACTGCTGGGATTGAATAAGGCGCCGACGACCCCCCGACCGACTGAGGGAGCCTAAATGGCAAGGTCGCACAGTAC
AGAGACCCCGTATCGCCGTTCCCAGTCTGTCACCAGccactcgcagcagcatcgcggCACGCCCGTGCTGGAGGATCAGAACTACATGAACACCTTTAGC
CCGCCGACCCACGGCGTCTACGTCATGGAGACGCCGCAGGAGGGCGATGCGGCGCCCGATGGAAGGCGCTCCATGCGCCAACTGCCGCCCGTGGACCAGA
ACGGATCGTTCCGGCAGCACCACGGCGTTACGCGCGGAGCCTCCGGCGGCTTCGTCACAATGgacaacggcagcaccatcagcagctccagcggcaaCTA
CATCGACACGATGAGTCTGAACAACAACATGAGTGCCAcggcgcagcagccgctgaTCTCGACGCCGCGCGTTACGCAAAAGAACATCGTTCGAGTTATC
GATAAGGACatgacgcagcagttccgCGGCCGCTCCAAGTCCGTCGGACAGGGACGTATCCGCTGGTTCGAGAACCGCAAGTCGCAGCTCCTAGGTTTCT
GCCTCACGATGGCATTCCTAGGTGTGTCTGTCGCAATGTACAACTACCGCTGGACGGGACTTATTGCTGGTTCAGTGAACACGATCATCTGCGGCTCTGC
CGTCGTGATCACGTACTGCCGCAAGAAACAATGGCATCAGCATCCGAACCCCATCGTGCACAACCGTTCTGTGCTGAGTATTTTCATGGCAGTATGTTTG
CTGTTGAACGTGCTCGTGGACTTCGACCCTAGTGGCTCCAATACGGACTGCCAGCGACTCGCAGGTATCACTgaattcttcttcttcacaggcGAGGCGT
GGGGTCTCGTCATGGCTTGCgatctcttcttctcggtaTGCATCATCCAGGATTGTTGCATGCTACTTCTTGCTACAGCTATCCGAAGCTGACACTAACT
ATTCTATTGTACAGCTTACGAGTCCTTTCACGAGCTACAAGCGATTGATGAAGTTCTACCACCTTTGGGTGTGGCTGGGAGGCATCACCATGGGCGTGAT
CACGTACTCAGTACAGGGTGCAGGTGGTTTCTTTACCGTGGACGGCCAGTCAATGACGTACGAATCCGACACAGACACGGTTATCGGATTTTGTCTTGCT
TCGTCGCGGATTTGCTGTGACTCTGGCGAAACTTGCCCAGACACTGTGACGAAATGCTCGACCActtcgagcttcttgaacgctCAGAAATGGTACGTGA
ATGGTCACAAAACTTTTCATCTGGATAACTTGTATGTTGGTACTCGTGAAGAATGAATCACTAACGAATTTGTTATTGACCAATTTTTACAGGCCCTGGA
TTTTGATTtactgcttcgtgctgctggtgctgtttgTATCTGTGTGGTAAGTCTCTAACTGAGCTGAGTGAGTGCTTTCGTGTGTATCTAATGGCatgtt
ttttgtgtgtgcAACAGTGTGCTAACATTGGCTTGGCACCGACTTTACCTGCGCGGCGTCCCCAAGACGTACAACATTCGCCTTCGTGTGCTGAACTACA
TTTCTTTGTAAGAACATCCGTTCTGTTTGTTGGCTACAACGCAAACGAACTTGTATCTAACATAGTTCGGCGTTTCGTATTTGCTCTCTATGACCAGCTT
CACCGGTGCCTATGTTTTCTACtggctgctactgctgctgctgtacatgtgcgcgtacttcttgtcgACGAAGAGCGACACTTCGAACTCTAAGGCAGTG
GCGCAGGTGCTACGTCAGCTGGTCATATTTCTCATTTCGTCCAAGGGCTACTTGGACTATGTGATCTGGTTCGCTGTGAACAACATTGAGAGAAAGGGTG
GAAACGGACATGATGAATCAGCAGATGTTGATGTCGACTTGAGCCCGCAGGTAAACACAGCACTGCGATCGGAGATTTTGTACTACACTACGTCTGGCAT
CAAGGAATCTGTTCGTGCGGTGACCGACGAACTGATCTCCATCCCGATCTCTGGCGAAAGCGAAGCGGTAAGTTATGCACTTGTTTTTTAGCTATGGCAC
ATGACCGGATACTTACTGGTGTCTATGCCGTCTAAATTTCAGGGCAAGTCCATTAAGTTCTGGTCGTTCTGCCCCGCTTCGTTCCGCAACATCCGTCTGA
CGTTTGGAATCAGTGATGCTGACTACATTCAAATGTTTGGCGCCACAACCAAGGAACGGTTCAGCGAAGGTCGTAGTGGTGCTTTCATGTTCTACACGTC
TGATGAGAGTTTGATTGTGAAGACAATGTCGCCCGAAGAGTGCGCGTTCTTGCGCAAGATGGCACCTAACTATGAGGCCTACATGACCAGCAACCCCGAT
ACACTTCTGACGCGGTTCTATGGCTGCCACTCCGTCTCGCTGTACGGCAAGATGTACTACTTCGTGGTCATGGGAAACCTATTTTCGGACACAGATGTTG
TGCACCACCGTTACGATATTAAGGGATCGTGGGTGGATCGTAATGCGAAGGTGCCGAGCCCCGGTGACAAGACCGCGTGCCGATACTGTAACGCATCGTA
CACGTTTGGCAGCACCAAGAACCAGGAATGTGGTGACGGCATGAACTTCCACGAGCCCGATATTGTCCTCAAGGATAATGACTTGATGACCAAGGTACGT
CTTTTGCTTCGAGTTTAACTTTGTGTGGTGTCATGCTTGTGTGGAAGTATGGCGACTTACCTATTTTTTCTGGTACAGATTCGAATCGACCCAGCCACCG
CACACCGCATCTACGACCAAATCCACAAGGACAGCGATTTCTTGTGCTCTCAGGGCATCATGGATTACAGTCTACTTATGGGCATTCAAAGCTCCGAGTA
CTTTGTCGACACAAGCCAGCTACCGCAAGCTCGCCGCGATCTGCTCTTCACGCAACCCGCGACGAGTGTGGCTGGTCCGTCGCTCTACCATTTCGGTATT
ATTGACTTCCTCCAGCAGTGGTACGTAGAGACTTCGAGTGCCAACATCTTGCTTGCTGTCTTTCAGTTTGATGACCTCTTGATGCTTATCGTTTACAGGa
cgttggagaagaagatggagcgTTTCTACAAGACTTTCGTGAAGCGCAAAGACCCCGAAGGCGTCTCTGCACTGCCGCCGAAGCCTTACAAGTTTCGTTT
CCAACAGAAGATGTCGCGCATCTTCGCACTGACGACGCACACACGCGCCGAGAATGACACGGCGTTCAACCACAACTACCCGGCGCTGATCGATGTACTG
GACCAGGGCAACTATGAcgcccagcgccacaacACCTTCGTCAGCAACTCGGTGGTGGACCAACGGCCGGTGTTCAACCCAGACCAGTACCAGGACGTCC
GCGCGGTGTAATCAAAGCATAATGAGTTAACCAAGGGATCAAGCGCGTGGtgtgaagcagcaagcatcATGGTGCATGGTGCCCCACTTTTGATAAGTAG
GAGAGAAGAGAGAAAGAGAATCATTTTATAAGTTGGGCAGTCGCGTTGGTGTTGATTCCTACTTACTGTTTCATGTCTGTGACCCAAAGCCCGATTCTTA
TGGAGTTCTAATTTCAGCCAATTAGATCGCCCCACCTAGCGCTATCGAAGCTCCCCCTCAATACAGAAGTCGACCTGCTGTCAACATGGTGAAGGTGCGG
GTTATTGCTCTCTCTCTGTGTGTCTGTGCTGCTTTACTCGCGTGCGGGACTGTTGGTAGCTATTATCCCTGATCGTACAGACGTCACTGACCGCTTGGCT
GCTTCATGGACTCTCTGCAGGCGTCGTCTCCGAGCGTGAAAGCGATCTTTATTCTGGACAGCGATGGCAATCGCGTGTGCGCCAAGTACTACGACAAGTC
ATACCCGTCacagaaggagcagctcgcactggagaagaagctgtacgccaagaccaagaactCGAACGCTCGTCTGGAAGGTGCGAGCGTTGCTGTGACG
ACGATAGTGTAGGGACAGCATTCTGACCGACGTTCTTTGTTATCAGCCGACATTATCCTTATTGAGAACGTCGTGAGCGTGTACCGCTGCGGATCGGACA
CTACGATGCACGTGGTTGGGTCGGCTTCAGAAGTGAGTTACGAGGTCTCTctgacaacagcaagaaggacTGGACTGGAAGCTTATGGATCGGTGTGGTT
GTGACTGTTCCTGGTAGAACGAGCTTATCCTGTTGACCGTCTTGGACTCGGCTTTCGATGCTGTTAGCAACTTGCTCAAGTACGTCGTTTGCTGATATTG
TTGGTATTTTAGCTGTGGAGTTTGAACGTGAGATACATGTCCGTTGTTTGCGAGTCTAGGGGACGGATGGATCGTCATGTGATGCTGGACAACatcgagc
tggtgctgctcacgttcGATGAGGTTGTCGATGGCGGGTAAGATACACGAGTGTTTATGTGTTGTCTGTGAAGTACTCGCcttgatgacgatgctgaTGA
TTTTGCTCAACAGAATTATCTTGGAGGTCGACACGCCGTCTATCTCGAACCGCGTGCTCATGCGCGTAAGAACATCCGTGCTCCCTTTTTGGCTTGTTAT
CGTGGTCCACTGACGAACTGTTTTCTACTGCGCAGGGTATCGACAACGAAGTCCCAATGGCAGAACTCTCCATTTCACAGGTGGGTttgcgcaagaagca
gtcgTTGAACTGGTGTATTCTGCGAGATGCTCTTTGCTCACACTGTTGTAACTTTTGCAGGCGTTCGCTTCGGCTCGCGAGCAGTTTTCGCGCTCCTTCC
GCAGCTAGACGGCATCCTGCGTGCCACATTAAATGTGCCTTTCTCTTCTATCTCCCCTTCTTCCTGAACACGACTCCGTTGTGATTTTTTTAATGGTGTC
CTTCATACAGTTCTGTGTCCGTGAGTTGATCCATCACTTTACTCAAGCCATCTAATTCGCCATAATGCGAAAAGCAATTCGCTTCAActattggttaaaa
ataCAGCAAAATCGGAAGCTTGTCATTTTCCATCAGGGAAGTTTGCACTACAGGCGAGGTGGTGATCAGTAGCTGACCATGACGGTaaagctggagaagg
aggacgtACAGGAACAGGAGAAACCCTGGGGACGCTTCACACTCGTGTCCAAGGAGCCGGCGGAGGACAGTGACCACATCTACTTTACGAACCAAGTGAC
TACGATCGGCCGCAACAAACGTCGCTGCGATCTCGTGATCAACAAACtcttcatcagcagcgtGGTACGATAATTGCTCAGGGGACTGACATCATTGTGG
GTAATGGTGCAGCTAGACGATGGCTCGGCGTCTAATTGGGACGATATTGTGCTGTCTGTTGATTGGGTTTGACAGCATTGCGTCGTGCGGTTGGACGGCA
CGGACGATACCGGCGAGCCCCTTGTCAAGCTCCATGATAACAGGTTCATCAAGTGGTTTTTGGCTTTGGTTGAGGGAAGGTTGGAAAATTAACGGTGATG
TATGCTGCAATGCAGCCGTAACGGTATCTGGGTCAATGCGGATCGTGTAGGCAAAGGGGCCTCAGTGCGGTTGGGCAGTGGCTTTACAGTTCACTTCACT
AAACCTGGGACGACACTGGCAGGTACTCAAAGTGAGGATACTATGTAGATGCATGCCTTCATGTGCTAACTCTAGTGTGACGTTGCGACTGATTCGCTTT
GCAGGGGTCACTCCGATGGCTTACAAGTTTGAGTTTCTCAAGTACGTGCAACAAGCATTCGTGGCACTTTTCAATCGTCGTGTCTAAAAATCTTTTTGGG
TATGTACTGACTGCTTTAATGTGTTAACTTGGCTTCTTTAACAGCCCCCATGGTTCTCATTCATCCTCTCCAAAGAGCAAGGCGAACGAAGCACCAGAAG
ATGTTGATATGACTGTGGTCGCGGACGAACCTTTCGAGGCAACACAACTGACTGCACCGGTGGATCCACCGTCTCcgtcggagaagaagcgcaagcgaaC
GGACGAGGAGCCTGCAGTCATTGTTGTTGCCACTCAAGAGCTCGAGAGTAAACTCGAGGCTGCAGAAAGTCAACTCAAAGCTGTAGAAAGCAAACTCAAG
GCTGCTGAAACCCGAGTAGCTCTGAATGAAGTGTTGGAGCAAACTGTGCAGGCTCACGTAGATAAACTTGCGCAAGAAAATTTGGACTTGATGGCCAAGC
TAGAGGCAGCTTCGGCGGAGAACCTTCAATTGAAGACAGATTTAGCCGCAAAAGTCAAAGATATGGAAGTGAAGATCAAAGAAGCAACGAAGCAAAGTCT
GGAAGCGGCTTCAAAAGAAAACCTTAAATTAAAGGAAAAGTCGGTTGCGAAAGAGAAAGCTATGGAGACGAAGATCAAGGAGGCCCTCACGAAAAGGTTA
GAGGCCGACCGCGAGGCAAAAACACAAGAAATGGCAGCCAAGCTTAAAgaagcgacgaagaagtacCAGCAAAAGGTTGAAGCAGAGCACTTTGAACAAC
GAAGAGAAATGAGCGAGAAGATGGCTGCTTTTGCCAACGAGAACGAAAGGCTACAGACAACTCTCGGTACGAaagcggaagagctggccgAATGTGAAGA
TAAGATCGCAAGCTTCCGGGAGACGGTCTCCACTTTGGAGGAAAAGGTCACCACCTTAAGTgcaaaggagaagaagttggcagAATGCGAGGAAAAGATT
GGTGAtctggaggagaaggttAGCGCGTCGAAGGACGAAAGCTCGGAGattcttgggcttcttgctgcagcagaagaaaaggtcgttgctgcagaaaaCA
AGGCTGCCGAAGCTGCTatagcagctgcagctgctagTTCCAATGCCAGCAACGGTGCTGATGCGAATGAGCGACACAAGTTGCAAGAAGCTATTTCATC
TCTCCGAATCGAGCTCGAGACGTATCGAACTCAGCTGGCGAGCCGAGAAGAGGAGGTGCGTAGACCTTGTGGAGTTTTGCGGACATGCTCTAAATTCGAT
GGACGACTAATGATTTCATTCTACTTGCCAATTGGCAAAACTAGCTCGCGAAGCAGCACGCGGCCGCAACGTCCgtggcgacagcaacaacggtgCCAAC
GGCGAGCGTTGCTGCAGAGAGGTACGTCGTTATCACTACCggtattatacatgtaatcTCTAAGACTAGCAAGAAACTAATTGTTATTATCCGTCTCGTC
AATGAGCAGTATCGCACAAGACGACGATGCGGAGGCTCTACGCGCCCGATTAGCTGTTGCATTGAACCTGTttggccaagtgcaagctCTTGGCCTCCAG
GGTGCGACCTTGATCACCGGAACGAACAGCCCAGATCTGGGAGACCTTCACCTTTTGTCGGTTGCGTCGGCGGAGTCAGAacgcaccagcacagcagTGC
CGAActcgccatcatcttcgcccACTAAAGAGGGCCAACAACATACCGAAGACGAACCTAAAGATGCATCTGTGAAGAAGCCCGAGAAAAAGACCGTGAA
GATATGTCCGAAGAAGGCCGCAAAGGAAGGTGACAGCGAGATGGAGCCGATGGAGGACGGTGTTAACGAACCAGCAGCCGAGCCCaagtcgtcgccgtcc
aagTTTAAgcgagagaagaagaagtcgaacaAGCAGGCGGCACCTCTGTCTGCGGCGATTGAAGCAGATGCCGCCTCGGCAATTGCAGCTATGGCATCAG
TCGAAAGCAGTGGCAAGAGCTCGCCAAGTGACGCCAGCACTGCAGTAGCcagtggcgatggcgacggcgactgGGAAATGCTGGAGTGAACATGCAACAA
GCCAAGCCAATTGAAAACATGCAGATAACTGGGTAAAAAGGCTTGTGGGCGTGGAGATACTTGTATGGATATGCCGCGCAATGCGTGGTGACGTATTTTT
GTTGTGAGCTCTCCGTGTCAAATGAGTCCACAACACAGGATTTGCAATTATTGACCAATCAACGGCCTCGCGCTTGTTTTTGCCACAACACCATCCAACA
AATTGCCAAATTGCTGCTTGGTGCGGGTGGTCGGTCCTTCACTACGAGACTCGCCCCCGAAGCCACAAGTCCTCCGTCACCATGCTTCGCACCGCCTTCC
GCCTGCGCACTGCTCTGCCGGCTCAACGCCGCATCGCCGCCTGCGtcgcgcgcagcttcacctcgtATCCGCCCCACGAGGTCGTCGGTCTGCCTTGTAC
GTCAATCAATCTAAATTTCGATGTCCTAGCAGATTTATTGCCGATCTGACAAAATGTGTTATTATTTGCTCATGCAGCGCTGTCCCCGACCATGGAGACG
GGCAACATGTCCAAGTGGAACCTGAAGGAGGGCGACGCCATTTCCGCCGGTGACATTGTGTGCGAGATCGAGACGGACAAGGCCGTCGTCGACTACGAGG
CCACAGACGACATGTTCCTGGCCAAGATCCTCATACCGGAGGGCGCCGAGAATATCCCCGTGGGTCAGCCGATGATGGTCGTgtgcgacgacgaggaatc
GGTCGCTGCCTTCAAGGACTtcaagctggaggacgccCCGGCCGCCCCCGTGctctcggaggaggagaagcccCCCAAGAAGGAGGATGTGCCTGTGAGC
GCCAAGACCAACGAGCCTGTTGTTCCCCAAGACTTTTTGGTGACCTCGCAGGCCACGCAGAAGACGGTGGCCGGCCCGGCCATCCCGGCGACCCCTGCTG
CCAAGGCTGCGCCTGCCCCTAAGGCTTCCGCGCCCGCCCCGGCTGCCAGCGCCGTGTTCGAGGAGAAGTGGGGTCTTggcatgaagaagagcgccatctc
cacgagcatcatcaagaagcagcaggcgtATATTGCCCTGTACGGCATTACCGGCATGACGCCCACGGCGCTGCCGGAGAAGAAGTAATTTTTGGCAAGC
AAATACACCTTGCGATGCAAAACGCTTGAAGGAACGCATTGCTAATTTGTTAATGAAAAGCGCGTAGCTAAGCTAGCTTGCAGATGCATTTGAAGTctca
actacatgtagtaaagTTTCTCGACTGAGCTGCTATTGTGTCTTACTGAGGGACGGTGATGCTCATCGAGTGGACTCTTTCAAGGTGACTGAGCACGCCA
AATGCGTCCACCGTGAGGAAGTCGAACAGTCCCGGGTGCTTCGCATCCAGAGCCTGCACGATAAAAAGAAGTAAAAGTCAATGGCATAGTCTAACTATGT
AGAGAGCACATGGTTCCAAGAGGGAAGCAGAGAGGCAGTAAGACATACCTGGTACTCATTCAAGTCAATGACTCCGTTGTGGTCCAGGTCGGCGTCCAGG
AAGGTGTTGTCCACAATATGGGCCAGCTGAGCCTCCGACAGCGATATTTCCAGCTCTGCACATCCAGCACACCAGGAGTCAATACAACCAGCACACAAAC
ACatcactgcagctgcatttCAAGCAGCTGGCCCAAGAACCACCGGAAAGCACGCACCGTTGCATTCATCAAGACAAGAGCGCAAGAgctccgtcgtcat
cttcttcgtgatgAATCCCGTGCCCTGCGGGTCCAGTAGGTAGAAGGACAGCATGAGTTTCTGCTCACGCGTCGCCTTCtgactcagcagcgacaagccC
TTCATCAGATCCTCGAACGTCACCTACAACATCAAAACACCACATCAAACCACCAGCAATAAGCCTTCTAAAGTTCCACAGCATCCCGACAATTGCATCC
CTCTATCTCCCTCTTACATGTCCCTTCTTGTCCATGTCAAAGATCGCGTAGAGGCGGTTGACATAGAggctggaggtgctgccgtcgccgccCGCCAGGA
AGCGGAAAAACTCATCCTTGGGGATCACCACGGCGTCGTTCTCGTGCTGACCTAGCACCGCTGCCAAATGCTTGCGAATGGACAGCATCTCGTGCTGAGA
GAAGACGGcggacacgtccacgtcggccAACTTGGTCTCTAGCAGCGAGTGTGCAGGCGTCGGAGGAGGCGCCGACGAGGTGCGAGGAGCACTGGAAGGg
gaagcagctgaagccgACACATAGGCTGGAGGGAGGGGGGAAGTAGACGCGGGCGCACTAGGCGGAACACTACGCGAGGCGCTCGTCGGAGGCGGTGACG
GTTTGGCTTGTTTGTTTCCCATGATGAAAGTGATCCAGGACTGAGAAACGGAAGTGAAGGATTTCTTGACAGTGGACTATTTTGTGTGTGGCACGTAATG
AAACGAAAAACTACAGATACAGACAATTAGAAAATACAGCAATCGACGAAAATGGTGACAGTCCGAGCGTCGACGCGCGTGCAGGAGGAAGGAaaggagg
cggcggtggccgtTCCCAGCGAGGTTGCCGAGGCTATTGCTATGGTGCGGAGCGACTCTCCGCTCGTTGCGGCTGAGGGCTTCTCCAAGCTCTCGCACGC
GACGTTTAACAACCGTGAGTTGCCGACATTTCTTTTTTGAACGGCTGAAAATGAATCTGACCAACGTTCTGTGTGTCTAGCGGTGGGaaaggaagcagca
ggcgaaATGGGAGCCATTAAGGCCATTGTGGACGCTATGGAGCGCAACATCTCCAACGGAACCGTGCAGGAAGACGGCTGCCACGCGCTGCGCAATGTCG
CATTCCACTGCTGTGCGTCTGGAAGCTGAAACGCCCTTGAGcgctgcaggaactggaggaTTGACAATGTGGGTTGAATGTCTTTGATGACCTAGTGCCT
AACTTGGTGCTGGCACGAGAGCAAGGCGcgattgctgctgtgctcaaggcgatggagacgcACCCGGAGaacgaagctcttcaagccGAAGGCTGCTGGG
CACTGCTGGTCTTCTGCTCCAACACGGGTACGCCTTTATTCAGTTGAATGGATGCCGACGTGAGATCTAAACTGGTTGATGCCGACTGTTGCATTCTGAG
CAGAAGAAAACGCCGCAGTGGCCAAGCCGCATGCGTCGCTGGTGCACAAGGCCGTTGCTGCGTACCCGACGAACGCCGACATCCAAAGCCGCGGTCGCTT
TCTTACGGTGCTTTTTGCTTGAATTTGTGCCGTTAGTCGTCGAGGTTTCACACTAGGGCAAGACGCACGATCGGATTCCGAAGCAGTTTGCGAAGCGTGA
CGAAGTCGTCGAGCATATATTATCCTGTCTTTCTGCCTGTGTACTCAATATTGTTTGCAACGGCACCAGCAGATCATTGGTTTGGCCTACTACTGACTTA
tacttgctgcttgaacgACCCGTAGCTTGCAGTCCCGTAGCCGGCAGGTGACTCGTAGAGGCCATATTCCGGGTGCTTGTGGCGCTTGTGGATGTTCTCT
AGCTCCATGAGGCTGAGCACGCTGGAGCCAAGTCCGAGCAGACAGCCCGACGCGAAGGGCACCACGCACGCCTGGAACGAGAACAGCACCGAGAACGGGT
CCAtgaactgcagcgtcgacgacagGAAGAAGCCGACCATAGCCATCATGTTCAAGCCTGCACATGGAGAACCACTTGAAAGTCAGCACAGGTTTTGTCA
TAACAGCATGTTTGTGAAACATAGACTCTGATGAGAGCTTTTAAACGTACCGGTGACCCAGGTCTCGAGCGTCGTGAGTCGGCACGAAAACCACTGGTGG
ACGACCTCGACGTGCGCCAGGTAGgcgctgagcagcagcaggaacgatCCGGCGAAGAACGGCACCCAGTAGCCCACGATGAGGCTCAGGTCGTCGCGCT
TGACGTCCACGATTCCGAAGTTCTCCGTGTCCGCTCTTGCCCACACGTACGCGCGAGCAAAGACGTAGAGCATCGACCCGAGCATGCCTAAGATGGCAGT
CCAAAAGTCGATACGGCTCGGGAAGAAGCCCACGTACTGACGTTCCAGCACGGGCTCAGTACCGTGGAAGTACTCCTCCAGCCAGATCTCGAGGTTGTGG
CAGCAGTTGATTACTTCCAGGTACGTGACGGTGTGGTaagcgaggaagaagacggcggccagcagcagcggcaggtcCACGTACGAGTGAACTGTGCTGC
CCGGCTCGCGGGCAGCCTTGGAGCCTTGGGTGCCGTGGGCCATAGCCTCGCCCGTGGCGCCCGTGATGAAGAGCGTGAAGGCCACGATACCGCAGAGGCT
GGCCCAGATGCTGAGCGAGTAGACCTTCCAGTTCTTACCGTGCCAGGCGCGGTAGagcgtcgtcatcatcttgcGGTGCGCGCGCGAGGACCAGACGATG
CGCTTCTGGTCCATGGTGTAGAAGTCCACGAGCGTAGGCGAGAAGGCGTCGACGCCGTAGTAGACCGAGTTGACGCTGTCCGGGGCGGGTACGATGAGCT
CCTCGGAGGCCACGCGCGAGtaggacgacgacacggacgaggcCGTGGGGCTCGTGGCAGCGTAgccgccgtgctgcagcagcggcaggtccttcttggc
caccatgTTGCGGCCTGAGGATGGCGTGGCAAATTCGAGACTCCCTCGGCGAGAGGCAGCTGTCTTGTATGGGCTGTCTGTTTCAGCGGTTGACGTTGGC
CTGGAAAATCTGGAAAAACTTTCCGCGTGCGTTCCTGAAGGTGTATTTTTGGCCTGGCTGGCGGTGCAGCGTCTGAGACTGAGTCGAGTCGCTTGATGCA
GCTAAAGGAGCTGCTCGGCTGAGTGATGTGCGCGCTGTCGGGAGAGAAACTAAATGGCAGCTCACGAGCGCCAGTCGGACGCTATGAATCACAGCCAGCG
ATCTTTTGAGGTCTGGTGCGAAAGGGAGGCGTTGAAGCGAAGCCCGCGCATAAACGTCCATGTTTCGATTTTTGAGAGGGAAACCCAGCGGGCAATATCA
AGCCTTAATTCAAGGTGGCTTGAGCTGCATACGGTGCATGTATTGCCATCCCTTCACCGCCGCGGAGAGCACGTTGTGCTTTGGGATGTATGTACGCGGG
CCGGCTGTCAGCACGCAGGTCACCTGCCAGATGGCGCGGCCTGGGGTGCGCAGCTCGCGTCAAGTGATGATGCCAGCTCTGTTGCATTTCGAGCAATGGA
ATTCTCGCAACGTcttcacgacgacgactctGATAGCCTCGAGATAATCTCGGAGATTGTCGTGGCTTTGAGGCAAAGCTACGTCAATCGAAGTCTTTCA
GGTGGTGCCGCGTTGGTGTCGAGCTTCAAGCACGAAGGCGATCCCCGCATATGGCTGCCCACTTCAGCTTCGAGCGGTTGAACCAGACCAGCCGGCGTCA
GGATATTGTCTGCAACGCACACACATCCTGGCGTGGATATCTTGCATTAATGCTCCGTTCGAGCGCTGCTCGCTTTCGCCTTCCCCACCGTCAgtcttct
gctgcgttggataaggtgaaggtgacggGCAACATGAAGTCCATAGTCTATGGGCCATAGAGTCCATGAGTCTTCATCTGATTCCCAGTGGCGCGCCGTT
ATTGGCTGGTCAAAGGTCGCTTGACAAAAAGTTCGAAAAAGGGAACGTTCGCGGAACCAGCTTGTACCGACATATTACAGCTTTCATCGAAGCGGATATT
TTGCTaattcagccaatcaaacCCCGAAAAAAACGCCCTTAAAAGTACGATCCAAATTTCCGCCGCCCCATGGCGACGAACCACGCCTTCGCGCTACCcc
tggcgtcgtccagcgacgacgacggtgacaCTGACGAACGCACAGGCGTCTACAGCTTCGGGCAGGTGCGTTCACCTAAATAAACACCAAATAATACAGC
GTGTCATGCCACTTTAACGTCAAAAATGTGTGATGCGTCGAATGGCTCATTGCGTGACGCTTAGAACACGTACGGGGAGCTGGCGCTCGGTGACACAACC
GACCGCAGCAAACCGACACGAGTAGATTTCGGTAGTAGCAATGACGGCAAGCACGTCGTGGATGTGGCCTGCGGGAACGAGCAGACTGCCATTCTGTTCG
GTGAGTCGGCAGCGCGCGTATTGGTATTGGTTGCAGTGTGGCATTGCATGAGCACTGGTACAAACGCTTTTTCGTGCAATTGGGTGTTCGTTTGCACTGG
TTTATAGAGGGTGGAGACGTGTTTACATGCGGCTATAATGACAGGTGCGTCGGCTTTTGCTGTTCTGGATGACTCCGTCAGTGTAAATATTGACTGTATT
TGCAGTGGCCAGTGTGCAATCGGCTCGACGGAGCGGGTGCCCACGCTCCGGTTGTCTCCGGGACTTAGTTCCAACCGCACGGTGCGGATCTTCTCAGGGA
ATGGCAGTGAACACCTCGCAGCACTGAGTGGTAAGGATCCTTGGTAGACTAACGCTTCGAAGAGGATTGTAGTTCCTTACTTGTGAGGTTGTTATATGGC
GGCGGTGATTTTTTACAGCGAATGGAAACTTGTACACTGTCGGGTTCAACATGCGTGGGCAGTTGGGACTTGGCACTGCGACAACTGTGACGGA